Manipulation der Expression neuronaler Gerüstproteine mittels RNA-Interferenz


Bachelorarbeit, 2013
60 Seiten, Note: 1,7

Gratis online lesen

Inhalt

Abstract

Zusammenfassung

Prolog

Erläuterung gebrauchter Abkürzungen und Akronyme

§ 1 Einleitung

§ 2 Materialien und Methoden
2.1 PSD-95
2.2 Zellkulturen
2.2.1 COS-7-Zellen
2.2.2 Neuronen
2.2.3 Bakterien
2.2 Konstrukte und Sequenzen
2.2.1 Vektoren
2.2.1.1 pCMV-Tag
2.2.1.2 pEYFP-N1
2.2.1.3 pSuper
2.2.1.4 pLL3.7
2.2.2 Wichtige Sequenzen
2.2.2.1 pSuper-Erkennungssequenzen
2.2.2.2 Epitope
2.2.2.3 PCR-Primer
2.2.2.4 Oligonukleotide
2.3 Agarosegel-Elektrophorese
2.4 Polymerase-Kettenreaktion (PCR)
2.5 Klonierung
2.5.1 Restriktionsverdau
2.5.2 Aufreinigung und Vorbereitung auf Ligation
2.5.3 Ligation
2.6 DNA-Präparation und -Konzentrationsbestimmung
2.6.1 Transformation
2.6.2 Mini-Präparation
2.6.3 Maxi-Präparation
2.6.4 Konzentrationsbestimmung
2.7 Transfektion
2.8 SDS-PAGE
2.9 Western Blotting
2.9.1 Vorgehen
2.9.2 Antikörper
2.9.3 Selektivität des Knockdown – Positiv- und Negativ-Kontrollen
2.10 Fluoreszenz-Mikroskopie
2.11 Durchflusszytometrie

§ 3 Vorgehen und Ergebnisse
3.1 Klonierungs- und Arbeitsschritte bis zu den fertigen Konstrukten
3.1.1 pCMV-Tag 2A PSD-95 KDres
3.1.2 pEYFP-N1 PSD-95 KDres und pCherry-N1 PSD-95 KDres
3.1.3 Einbau NheI-Schnittstelle
3.1.4 Insertion in pLentiLox 3.7
3.2 Nachweis für Expression und Knockdown im WB
3.3 Quantifizierung der Knockdown-Effizienz
3.4.1 Titration von pSuper PSD-95 KD im Western Blot
3.4.2 Durchflusszytometrische Quantifizierung
3.4 Expressionsnachweis von pLL3.7 PSD-95 KDres-pCherry mittels Western Blot

§ 4 Diskussion
4.1 Laufverhalten von PSD-95 in der SDS-PAGE
4.2 Varianz bei Tubulin-Banden
4.3 Western Blot vs. Durchflusszytometrie
4.4 Theoretische Betrachtung der Durchflusszytometrie
4.5 Expression des lentiviralen Konstrukts
4.6 Zukunft des LentiLox-Konstrukts

Appendix
i. Spezifizierung der eingesetzten Zellen
ii. Zusammensetzung und/oder Herkunft verwendeter Medien und Lösungen
iii. Verwendete Primär-Software

Bibliographie
i. Veröffentlichte Artikel
ii. Sammelwerke
iii. Benutzerhandbücher
iv. Quellen im Netz
v. Sonstiges

Danksagung

Abstract

This thesis outlines the cloning and expression of various novel vectors which, on the one hand, are based on pSuper (and pLentiLox 3.7) plasmids and allow the gene-knockdown of PSD-95, a neuronal scaffolding protein, through shRNA-induced RNA interference. On the other hand, vector constructs created on basis of pCMV-Tag, pCherry-/pEYFP-N1 and pLentiLox 3.7 will give the opportunity to transfer different kinds of, in some cases knockdown resistant, PSD-95 derivatives into mammalian cells. The long-term aim is to combine the special features of these vectors in one construct: Of lentiviral origin, it will be well-suited to be transferred gently into neurons in vitro and in vivo. Inside the neuron, the gene for endogenous, “healthy” PSD-95 is hereby silenced via RNA interference. Meanwhile, a modi- fied, knockdown-resistant PSD-95 species is expressed from the vector, replacing the endogenous protein intracellularly. With such a vector at hand, it is possible to insert secondary mutations to the con- struct´s knockdown-resistant PSD-95 easily and fast. This allows a very quick and effective scan of dif- ferent mutations that are, e.g. suspected to be associated to certain diseases, as the infected neurons can be further analysed by various means, e.g. electrophysiology, in regard to the mutation´s impact on cel- lular constitution.

To prove the vectorial expression and function of RNAi-induced gene silencing in transfected cells, differ- ent techniques such as Western Blotting and flow cytometry (in case of fluorophor-tagged proteins) have been adapted and optimized.

These methods were then employed to critically analyze the created constructs in respect to various features.

Zusammenfassung

Diese Bachelorarbeit widmet sich der Klonierung und Expression diverser neuer Vektoren, die einerseits auf Basis des pSuper- (und des pLentiLox 3.7-) Plasmids den Gen-Knockdown von PSD-95, einem neuro- nalen Gerüstprotein, mittels shRNA-induzierter RNA-Interferenz ermöglichen. Andererseits werden auf pCMV-Tag-, pCherry-/pEYFP-N1 und pLentiLox 3.7-Plasmiden basierende Vektoren konstruiert, die die Einbringung diverser und z. T. Knockdown-resistenter PSD-95-Derivate in Säuger-Zellen erlauben.

Das langfristige Ziel ist es, die speziellen Eigenschaften dieser einzelnen Vektoren in einem Konstrukt zu kombinieren: Als Vektor lentiviralen Ursprungs soll er die Möglichkeit des schonenden Gentransfers in sensible Nervenzellen in vitro und in vivo durch Infektion bieten. Innerhalb des Neurons kommt es hier- durch zur Stilllegung des „gesunden“, endogenen PSD-95 mittels RNA-Interferenz. Währenddessen wird eine vektorkodierte modifizierte, knockdown-resistente Variante des PSD-95 exprimiert, die in der Zelle die Rolle des endogenen Proteins an dessen statt einnimmt. Liegt ein solcher Vektor erst vor, ist es schnell und auf einfache Art und Weise möglich, zusätzliche Mutationen in das knockdown-resistente PSD-95 einzubringen. Das erlaubt den effektiven Scan verschiedener Mutationen, welche zum Beispiel im potentiellen Zusammenhang mit etwaigen Krankheiten stehen könnten. Die Auswirkungen des mutanten Gens auf die Zellphysis können dann mit verschiedensten Methoden, etwa elektrophysiologisch, weiter untersucht werden.

Für den Nachweis der Expression der Vektoren in transfizierten Zellen und den Knockdown-Erfolg der RNAi wurden verschiedene Methoden wie Western Blotting und (im Falle Fluorophor-getagter Proteine) Fluoreszenzmessungen im Durchflusszytometer angepasst und optimiert.

Hiermit wurden die erhaltenen Konstrukte einer kritischen Untersuchung hinsichtlich verschiedener

Kriterien unterzogen.

Prolog

Die der vorliegenden Bachelorarbeit zugrundeliegenden experimentellen Arbeiten wurden am Neurowissenschaftlichen Forschungszentrum der Charité – Universitätsmedizin Berlin, Teil des Exzellenzclusters NeuroCure, in der AG „Molekulare Neurobiologie und -genetik“ unter der Leitung von Prof. Sarah Shoichet durchgeführt. Eine Kurzzusammenfassung des Inhalts der Arbeit in deutscher und englischer Sprache wurde bereits auf voriger Seite vorausgeschickt.

Die Bachelorarbeit insgesamt gliedert sich – abgesehen von einer die Thematik motivierenden Einleitung – in drei Hauptabschnitte (§§ 2 bis 4).

Im ersten der drei werden die eingesetzten Materialien und Methoden spezifiziert. Die meisten dieser Labortechniken werden im Laufe der zu dieser Arbeit beitragenden Experimente mehrmals Anwendung finden; sofern jedoch keine individuellen Änderungen im Vorgehen vorgenommen wurden – was sonst gesondert vermerkt würde –, ist von einem Verfahren nach den in § 2 dargestellten Protokollen auszugehen. Handelt es sich bei den Arbeitsabläufen um allzu übliche Standardmethoden, bescheide ich mich zum Teil mit einem Verweis auf das empfohlene Hersteller-Protokoll, dessen sich bedient wurde.

In § 3 werden dann das im Zuge der Experimente konkret gewählte Vorgehen sowie deren Ergebnisse vorgestellt und kurz erklärt.

In § 4 schließlich folgt die Diskussion der gewonnenen Ergebnisse, sowie ein kurzer Ausblick, welche weiteren Schritte mit den gewonnenen Konstrukten in Zukunft noch folgen könnten.

Hinweise auf gebrauchte Literaturquellen sind in Form von [ERSTAUTOR, Jahr] im Falle von Veröffentlichungen in Fachzeitschriften, mit [ERSTAUTOR, (Kurz-)Titel] im Falle eines Nachschlagewerks gekennzeichnet. Auf Produktbeschreibungen und Nutzerhinweise wird in der Form [Hersteller, Jahr], auf Internetquellen mit [URL-Schlagwort, Aufrufdatum] verwiesen. Alle Quellen sind dann, nach diesen Kategorien differenziert und in alphabetischer Reihenfolge im Anhang der Arbeit ausführlich einzusehen. Genaue Zusammensetzungen zum Einsatz gekommener Medien und Lösungen finden sich in alphabetischer Ordnung, zusammen mit einigen weiteren, nützlichen Informationen im Anhang der Arbeit.

Berlin, im Februar 2013

M. S.

Erläuterung gebrauchter Abkürzungen und Akronyme

Abbildung in dieser Leseprobe nicht enthalten

Für die proteinogenen Aminosäuren wird bisweilen der herkömmliche Drei-, zum Teil auch der Einbuchstabencode [IUPAC, 1984] Anwendung finden.

Antikörper gegen ein bestimmtes Antigen werden mit αAntigen abgekürzt.

§ 1 Einleitung

Das hochentwickelte Gehirn eines Säugers besteht aus einem dynamischen Netzwerk von Milliarden Nervenzellen (s. Abbildung 1). Diese Nervenzellen sind äußerst komplex1 miteinander verschaltet und ermöglichen durch ihre Kommunikation untereinander die Verarbeitung von Information. Die interneuronale Erregungsübertragung findet an Synapsen, spezialisierten Verbindungsstrukturen, statt. Der v. a. im Gehirn weitest verbreitete Typ [SHENG, 2007] ist die exzitatorische Synapse, die zwischen einem efferenten Axon sowie einem afferenten, dendritischen Sporn vermittelt und Glutamat als chemischen, d. h. unidirektionalen Transmitter nutzt. Dieser Botenstoff wird an der Präsynapse in den synaptischen Spalt sezerniert und diffundiert zu spezifischen Rezeptoren auf der postsynaptischen Seite, die, je nach Typ, verschieden auf das Signal reagieren.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 1. Schematischer Bau eines multipolaren Neurons. Abbildung von M. R. Villarreal, Hamburg.

Die ionotropen Glutamatrezeptoren etwa öffnen sich glutamatabhängig und erlauben so den vom elektrischen Potentialgradienten getriebenen Influx von Kationen2. Einströmende Natriumionen sind hauptverantwortlich für die Depolarisation der Zelle und damit, falls diese zur Auslösung eines AP ausreicht, für die Transmission des Signals in elektrischer Form. Die Stärke der Signaltransmission ist dabei nicht a priori determiniert und statisch, sondern kann modifiziert werden, was auf molekularer Ebene hauptsächlich durch Kalziumionen und metabotrope Glu-Rezeptoren gesteuert wird. Stellglieder für die Transmissionsstärke können histochemischer, wie etwa durch mittelfristige Veränderung der Zahl an Rezeptormolekülen, oder morphologischer Natur sein, z. B. durch Bildung neuer oder Abbau nicht mehr benötigter Synapsen. Dadurch entstehen auch längerfristig neue Verschaltungsmuster, die charakteristische Aktionsprogramme widerspiegeln. Diese synaptische Plastizität und das Prinzip der synaptischen Assoziation ko-aktivier Neurone (HEBB´sche Regel) stellen die Grundlage für Lern- und Erinnnerungsprozesse dar. Doch wie ist bspw. die Rekrutierung zusätzlicher Rezeptorproteine zur Postsynapse auf zellulärer Ebene organisiert?

Elektronenmikroskopische Untersuchungen zeigen unterhalb der Postsynapse ein membranassoziiertes, elektronendichtes Geflecht3 von Proteinen, die PSD4. Das Gerippe dieses Geflechts wird durch Gerüstproteine wie PSD-95 gebildet (Abbildung 2), die heteromultimerisieren und aufgrund ihrer vielfältigen Interaktionen mit anderen Proteinen die Bildung großer Cluster von Rezeptoren, Signal- und Adhäsionsproteinen in der Postsynapse dirigieren [NIH Gene, 10.10.2012]. Durch die resultierende physische Nähe von membranständigen Rezeptoren und cytoplasmatischen, signaltransduzierenden Proteinen wird eine Signalkopplung gefördert [KIM, 2004]. Auch bei der PSD handelt es sich jedoch keineswegs um ein statisches, sondern ein flexibles, dynamisches Netzwerk: Die „Struktur und Zusammensetzung der PSD wird [...] durch externe Stimuli und synaptische Aktivität [modifiziert]“, die „Häufigkeit und Aktivität seiner Konstituenten dynamisch reguliert durch Phosphorylierungen, laterale Umlagerung, das Ubiquitin-Proteasom-System zum Proteinabbau sowie die Neuverteilung spezifischer Proteine wie CaMKIIα und AMPA-Rezeptoren hin zur und weg von der PSD“5.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 2. Schematischer Querschnitt durch eine Synapse mit Präsynapse (oben), synaptischem Spalt (mittig, ca. 20 nm breit [KANDEL, 2000]), mit Schwerpunkt auf der Postsynapse (unten). Gegeben ist ein Überblick über die Organisation und vielfältige Interaktion der wichtigsten Proteine der PSD. Man beachte die zentrale Rolle des PSD- 95 als strukturgebendes Element für verschiedene Rezeptoren, transsynaptische Zelladhäsionsproteine, andere Gerüstproteine und signalleitende Enzyme. Abb. aus [SHENG, 2007].

Untersuchungen wie von HOLMES et al. (2010), die Einzelnukleotid-Polymorphismen von PSD-95 in Verbindung mit der phänotypischen Symptomatik von neurologischen Entwicklungsstörungen wie WILLIAMS-BEUREN-Syndrom und Autismus bringen oder KRISTIANSEN und MEADOR-WOODRUFF (2005), die im Hirngewebe manisch depressiver Patienten eine offenbar nachteilige, reduzierte Expression von PSD-95 nachweisen konnten, machen dieses Gerüstprotein auch aus klinischer Sicht interessant.

Um solchartige Hypothesen über die genetische Veranlagung von Nervenerkrankungen stützen und die gefundenen Korrelationen durch den experimentellen Nachweis physiologischer Kausalitäten erklären zu können, ist es notwendig, die verdächtigen Mutationen (oder, um bei letzterem der obigen Beispiele zu bleiben, die verringerte Expression) des PSD-95 auf molekularer und zellulärer Ebene und parallel in Verhaltensstudien, etwa am Mausmodell, untersuchen zu können. Hierzu ist jedoch eine Technik nötig, mit der die jeweiligen Defekte überhaupt erst künstlich in Neuronen-Zellkultur und in vivo hervorgerufen werden können. Eine Methodik, die dies erlaubt, ist der Einsatz von RNA-Interferenz (RNAi) zum Knockdown eines Gens, besonders in Kombination mit lentiviralen Vektoren.

Bei RNAi handelt es sich um einen körpereigenen Mechanismus6, durch den die Expression von Genen zielgerichtet abgeschaltet oder zumindest reduziert werden kann. Er beruht darauf, dass im Cytosol doppelsträngige RNA von einem Proteinkomplex namens Dicer erkannt und in kleinere Stücke zerschnitten wird. Diese Fragmente werden von einem weiteren Proteinkomplex (RISC) gebunden, der den Doppelstrang entwindet und aufspaltet. Während der Leitstrang7 im RISC verbleibt, verlässt der andere den Komplex und wird abgebaut. Fortan dient der Leitstrang dem RISC als Prüfsonde, die mit homologer mRNA im Cytoplasma hybridisiert, welche dann vom RISC gebunden und in kleine Stücke zerschnitten wird. Dadurch fehlen der Ziel-RNA die 5´-Endkappe und die 3´-terminale Polyadenylierungssequenz, welche im Cytosol stabilisierend auf mRNA wirken, weswegen die RNA- Fragmente werden zügig abgebaut werden [KURRECK, 2009]. Auf diese Weise wird die Expression des Gens, das ursprünglich für die passende mRNA codierte, unterbunden [Nobelprize, 11.10.2012].

Der körpereigene RNAi-Mechanismus stellt einerseits einen effektiven Schutz vor Virustaxa dar, die doppelsträngige RNA als Träger ihrer Erbinformation nutzen [HAASNOT, 2007]: Injiziert ein solcher Virus seine RNA in die Wirtszelle, so kann diese von Dicer zerschnitten werden; RISC wird aktiviert und die virale mRNA abgebaut. Andererseits erweist sich RNAi als eine Kontrollmöglichkeit für Transposons [CHUNG, 2008], welche im Genom springen und dabei andere Gene beschädigen können.8 Darüberhinaus nimmt die RNAi auch in der Kontrolle zelleigener Gene eine entscheidende Rolle ein.9

Molekularbiologisch macht man sich die RNAi zunutze, um relativ einfach Gene in Zellen abzuschalten. Indem man in die Zellen geeignete siRNA einbringt, welche von der RNAi-Maschinerie erkannt wird, kann man gezielt den Abbau der homologen mRNA des betreffenden Gens veranlassen. Der Transfer der siRNA in die Zelle geschieht am dauerhaftesten in Form eines Expressionssystems. Hierzu wird die siRNA in eine DNA-Sequenz konvertiert, welche für einen sense-Strang, ein Nadelöhr, sowie einen antisense-Strang kodiert. Diese DNA wird in einen bakteriellen oder viralen Vektor kloniert, wo sie im allgemeinen unter der Kontrolle eines Promotors für die zelleigene DNA-Pol III stehen (z. B. Maus U6, Abbildung 3), da jene auf die Erzeugung hoher Kopienzahlen von RNA exakt definierter Länge spezialisiert ist [KURRECK, 2009].

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 3. Der Weg von der kodogenen DNA-Sequenz zur transkribierten und hybridisierten shRNA. Quelle: [Addgene, 12.10.2012].

Durch die Komplementarität von sense- und antisense-Strang können diese nach der Transkription hybridisieren, wodurch es zur Ausbildung der namensgebenden, doppelsträngigen Haarnadelstruktur der short-hairpin (sh)RNA kommt. Durch Dicer wird im Cytoplasma das Nadelöhr abgeschnitten, sodass die funktionable siRNA entsteht.

Der Einsatz von lentiviralen Vektoren im Gegensatz zu bakteriellen bietet zwei spezielle Vorzüge:

Zum einen stellt die virale Infektion, bspw. im Vergleich zur Nutzung kationischer Lipide, eine ausgesprochen schonende, wenngleich sehr effektive Methode des Gentransfers in die sensiblen Neurone dar [KARRA, 2010]. Zum anderen bietet die Nutzung viraler Vektoren die Möglichkeit, auch Nervenzellen in vivo gezielt zu infizieren. Hierzu wird das Lysat mit den infektiösen Virionen intracerebral injiziert. Durch Verwendung von Viren mit speziellen Tropismen ist es sogar möglich, die Infektion auf einzelne Zelltypen innerhalb des Gehirns zu beschränken, welche den entsprechenden Virus-Rezeptor auf ihrer Oberfläche präsentieren [YANG, 2006].

Bei Verwendung eines Lentivirus-Vektors wird das Genkonstrukt aktiv10 in den Zellkern transportiert und dort an zufälliger Stelle stabil ins Wirtsgenom integriert. Das hat den Vorteil, dass es nicht nur transient, sondern dauerhaftt zur Expression des eingebrachten Gens kommt.11 Es birgt aber auch das Risiko, dass durch die zufällige Insertion Gene des Wirts außer Funktion gesetzt werden, was wiederum unvorhersehbare Folgen für den Zellmetabolismus bedeuten kann. Das muss als mögliche Nebenwirkung der Methode in Kauf genommen werden.

§ 2 Materialien und Methoden

2.1 PSD-95

Im Fokus der Untersuchungen stand primär das postsynaptic density protein 95, PSD-95, aus der Farbratte (Rattus norvegicus forma domestica). Hierbei handelt es sich um ein 724 As langes und 80,5 kDa schweres Protein. Das Protein setzt sich – charakteristisch für ein Protein der MAGUK-Familie – zusammen aus einer Guanylatkinase-, einer SH3- und drei PDZ-Domänen. Der Aufbau des PSD-95 ist schematisch in Abbildung 4 gezeigt.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 4. Der Aufbau von PSD-95 mit Schwerpunkt den wesentlichen Strukturelementen, in abstrahierter, linearer Darstellung v.l.n.r.: Drei PDZ-Domänen, eine SH3-Domäne und eine Guanylatkinase-ähnliche Domäne. Aus [KIM, 2004], verändert.

PSD-95 ist in der Klasse der Säugetiere stark konserviert. So zeigt sich bei einem Sequenz-Alignment vom PSD-95 der Ratte mit seinem humanen Pendant eine Übereinstimmung in 92,8 % der Aminosäuren.12 Im menschlichen Organismus wird PSD-95 wird von dem Gen discs large homolog 4 (Dlg4) kodiert [UniProt, 6.10.2012], daher auch der alternativ gebräuchliche Name des Proteins, DLG4.

2.2 Zellkulturen

Für die Transfektionsexperimente werden Zellkulturen genutzt. Dabei handelt es sich um vitale eukaryotische Zellen, die in Zellkulturgefäßen in einem geeigneten Nährmedium kultiviert werden. Je nach Fragestellung der Versuche kommen unterschiedliche Kulturen zum Einsatz.

2.2.1 COS-7-Zellen

COS-7 ist eine Linie von adhärent wachsenden Zellen, die sich im allgemeinen durch eine gewisse Anspruchslosigkeit in der Pflege sowie relative Toleranz gegenüber Transfektionsstress fremden genetischen Materials auszeichnet und deswegen vielfältigen Einsatz findet. Die verwendete Zelllinie der COS-7-Zellen wurde ursprünglich vom MPI für Molekulare Genetik, Berlin, bezogen.

Bei COS-7-Zellen handelt es sich um Abkömmlinge von fibroblastoiden CV-1-Nierenzellen einer grünen Meerkatze (Cercopithecus aethiops), welche in den 60er Jahren des vorigen Jahrhunderts mit dem ROUS- Sarkomvirus (RSV), einem normalerweise Geflügel befallenden α-Retrovirus, infiziert wurden [JENSEN, 1964]. Durch die Insertion des revers transkribierten Virusgenoms in die Wirts-DNA induziert das RSV in seinem ursprünglichen Wirt Tumorentwicklung [MODROW et al., Mol. Vir.]. In simianen Zellen, die sich in der schnell proliferierenden Wachstumsphase („log-Phase“) befinden, beobachteten JENSEN et al. eine virusbedingte Immortalisierung. Durch ihre uneingeschränkte Teilungsfähigkeit etablierte sich die gewonnene CV-1-Zelllinie als geschätztes Forschungsobjekt. In den 80er Jahren transfizierte Yakov GLUZMAN Zellen dieser Linie mit einem Vektorplasmid, das ein mutantes Genom des Affen-Polyomavirus SV40 trug. Das Virusgenom inserierte dabei in das Genom der Wirtszelle; das Gen für den Enhancer großes T-Antigen, der für eine erfolgreiche Replikation bei Polyomaviren unerlässlich ist, zeigte eine normale Expression in der CV-1-Zelle [GLUZMAN, 1981]. Die eingesetzte Mutante wies jedoch im Replikationsursprung des Virusgenoms einen Defekt auf, sodass keine infektiösen Virionen freigesetzt werden konnten. Die so gewonnene CV-1-Linie mit Inserat bot nun den Vorteil, dass sich in ihr aufgrund des dort vorhandenen hohen T-Antigen-Spiegels auch T-Antigen-defizitäre SV40-Mutanten vermehren lassen, die selbst über kein intaktes Gen für den notwendigen Replikations-Enhancer T-Antigen mehr verfügten. Diese Viren sind zu einer eigenständigen Vermehrung nicht fähig und daher als Versuchsobjekte wesentlich ungefährlicher für den Menschen. Auch bieten diese Zellen aufgrunddessen den Vorteil, dass Plasmide mit SV40-ORI repliziert und mittels plasmidärer Vektoren eingebrachte Gene mit SV40-Promotoren exprimiert werden. Deshalb wurde die von GLUZMAN erzeugte Zellinie, die er COS13 nannte, in großem Maßstab für die Erforschung dieses Virustyps und darüber hinaus als beliebte Labor-Zellinie eingesetzt.

Die einzige Pflege, derer die eingesetzten COS-7-Zellen bedürfen, besteht in der Lagerung der mit Nährmedium14 befüllten Zellkulturgefäße15 im Inkubator (HERAcell von Heraeus, Hanau) und der regelmäßigen Passage („Splitten“) der Kulturen in ein neues Kulturgefäß. Der Brutschrank soll dabei konstante Wachstumsparameter in Form einer annähernd wasserdampfgesättigten Atmosphäre mit einer Kohlendioxidkonzentration von 5 % bei einer Temperatur von 37 °C gewährleisten, was in etwa physiologischen Bedingungen entspricht. Die Passage wird durch die beständige Proliferation der obligat adhärenten COS-Zellen notwendig, die der beschränkten Oberfläche im Inneren der Zellkulturflasche entgegensteht. Würden die Zellen nicht regelmäßig ausgedünnt, hätte dies ein Absterben der Kultur zur Folge.

Die für die Passage nötigen Pipettierschritte werden, wie jegliche Zellkulturarbeiten, allesamt steril auf einer biologischen Sicherheitswerkbank (Klasse II, Typ HERAsafe von Heraeus) durchgeführt. Die Zellen werden dazu nach einer Waschung in raumtemperiertem DPBS maximal fünf Minuten lang im Brutschrank mit Trypsin16 inkubiert, wodurch die extrazellulären Anteile der Oberflächenproteine, mit denen sie an die Gefäßoberfläche adhärieren, hydrolytisch gespalten werden. Wenn sich die Zellen gelöst haben, wird die proteolytische Reaktion durch Zugabe des COS-7-Nährmediums gestoppt17. Danach wird, falls nötig, die Zelldichte bestimmt (Scepter cell counter von Millipore), die Zellsuspension auf die gewünschte Verdünnung eingestellt und in das neue Kulturgefäß (Kulturflasche oder Well-Platte, je nach Verwendungszweck) überführt.

2.2.2 Neuronen

Für direkte Experimente mit Nervenzellen werden Primärkulturen der hippocampalen Neuronen von Mausembryonen am 18 Schwangerschaftstag (E18) eingesetzt.

Als Zellkulturgefäße dienen 12er Multiwell-Platten (im folgenden der Einfachheit halber kurz “12-Well“), die, je nachdem, ob die Neuronen später etwa für eine mikroskopische Untersuchung auf einen Objektträger überführt werden müssen, noch mit ethanolgebadeten und abgeflammten Deckgläschen bestückt werden können. Um eine hohe Überlebensrate der Neuronen zu erreichen, muss das Kulturgefäß dann mit einer Mischung aus dem Aminosäurepolyamid Poly-D-Lysin und Laminin18 beschichtet werden. Von der Beschichtungslösung werden über Nacht 0.5 ml in jedes Well gegeben und auf 4 °C gehalten. Am nächsten Tag werden die Wells einmal mit PBS gewaschen.

Zur Gewinnung der Primärkultur werden die 18tägigen Embryonen operativ entnommen, getötet, ihre Hippocampi nacheinander unter einem Binokular zügig auf Eis herauspräpariert und in eisgekühltem DMEM gesammelt. Zur Dissoziation der Neuronen wird das DMEM abgenommen und das Hirngewebe für 5 min im Zellkulturschrank mit 5 ml Trypsin inkubiert. Sodann wird das Trypsin mit 20 ml DMEM inkl. 10 % FCS inaktiviert und die Zellen schonend bei 300 rpm für 3 min absedimentiert. Der Überstand wird verworfen, das Pellet noch zweimal in 25 ml DMEM gewaschen und wie oben zentrifugiert. Nun wird das Pellet in 2 ml Neuronen-Nährmedium resuspendiert und die Zellen durch auf- und abpipettieren voneinander gelöst. Hiernach werden die Zellen in Neuronenmedium vorverdünnt, die Zellendichte gemessen und auf ein gewünschtes Soll eingestellt, bevor die Zellen auf den Platten ausgesät werden. Nach einer Stunde folgt nochmals ein Austausch des Neuronenmediums, mit dem auch tote Zellen und restliche Zelltrümmer abgenommen werden. Danach können die Zellen für längere Zeit im Inkubator gehalten werden.

2.2.3 Bakterien

Für die Vervielfältigung von (plasmidärer) DNA werden genetisch speziell optimierte Stämme der gramnegativen Enterobakterienart Escherichia coli eingesetzt. Je nachdem, welche Eigenschaften ein zu kopierendes Plasmid hat, wird einer der beiden folgenden Stämme gewählt. Ursprünglich bezogen wurden die beiden Stämme von Invitrogen/Life Technologies GmbH, Darmstadt.

- E. coli str. TOP10

Hierbei handelt es sich um einen E. coli-Stamm, optimiert für die effiziente Transformation (nach Lieferantenangabe bis zu 109 KbE/µg DNA) und stabile Replikation von high-copy- Plasmiden [Invitrogen, 4.10.2012]. Die optimale Wachstumstemperatur beträgt 37 °C und liefert, auch die DNA-Ausbeute betreffend, gute Resultate.

- E. coli str. Stbl2

Stamm Stbl2 ist hinsichtlich der Replikation instabiler Plasmide und speziell solcher, die retrovirale Sequenzabschnitte aufweisen, optimiert [Invitrogen, 4.10.2012]. Bei diesem Stamm fällt jedoch wie die Erfahrung gezeigt hatte, bei 37 °C und dementsprechend maximaler Wachstumsgeschwindigkeit der Bakterienkultur die Plasmidausbeute unzufriedenstellend aus. Bei langsamerem Wachstum auf RT über längere Zeit hingegen konnten passable Mengen an DNA erzeugt werden.

2.2 Konstrukte und Sequenzen

2.2.1 Vektoren

Als Vektoren eingesetzt wurden vier verschiedene Plasmide, die sich aufgrund ihrer speziellen Charakteristika für unterschiedliche Experimente eignen. In die jeweiligen Plasmide wurden dann die Sequenzabschnitte von Interesse kloniert.

2.2.1.1 pCMV-Tag

Als Vektor für die zu übertragende DNA wurde u. a. das Plasmid pCMV-Tag von Agilent Technologies, Inc., CA, USA, eingesetzt.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 5. Schematische Karte des pCMV-Tag 2-Plasmids. Die beschrifteten Sequenzabschnitte bedeuten (von der MCS ausgehend im Uhrzeigersinn): SV40 Polyadenylierungssignal, f1 Origin of ss-DNA replication, bla Promotor, SV40 Promotor, Neomycin/Kanamycin-Resistenz-ORF, HSV-Thymidin-Kinase Polyadenylierungs- signal, pUC Origin of replication, CMV-Promotor, FLAG-Tag. Abbildung aus [Stratagene, o. J.], modifiziert.

Bei diesen Plasmiden geht der MCS in 5´-Richtung die DNA-Sequenz des Epitops eines geläufigen Antikörpers (αFLAG oder αmyc) voraus. Bei der CMV-promovierten Expression in Säugerzellen, für die diese Plasmide hinsichtlich Codon-Gebrauchs optimiert worden sind [Stratagene, o. J.], entsteht dadurch ein Fusionsprotein, welches von dem jeweiligen Antikörper erkannt wird. Zudem besitzt das Plasmid eine Genkassette für die Kreuzresistenz gegen die Aminoglykosid-Antibiotika Neomycin, Kanamycin und Geneticin (G-418)19. Der prokaryotische β-Lactamase-Promotor sichert die Expression des Resistenzgens in Bakterien, der SV40-Promotor in Eukaryoten. Der Resistenzmechanismus beruht wahrscheinlich20 auf einer intrazellulären enzymatischen Modifikation des Antibiotikums, die die Bindung ans Ribosom verhindert.

Daneben weist das Plasmid den high-copy-ORI pUC [LIN-CHAO, 1992] für die Replikation in Bakterien auf.

2.2.1.2 pEYFP-N1

Der pEYFP-N1-Vektor stammt von Clontech Laboratories, Inc., CA, USA.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 6. Schematische Plasmidkarte des pEYFP-N1-Vektors (aus [Uni. Liv., 4.10.2012], verändert). In pCherry-N1 ist nur der für das Chromophor codierende Sequenzabschnitt durch den der Farbvariante ersetzt.

Der pEYFP-N1-Vektor ist als Plasmid so gestaltet, dass nach der Klonierung eines Proteins in die MCS sowohl Protein, als auch ein 5´-terminal anhängender Fluorezenzmarker im selben ORF hinter einem CMV-Promotor liegen (Abbildung 6). So kommt es intrazellulär zur Expression eines fluoreszierenden Fusionsproteins. Im Versuch eingesetzt wurden Vektoren mit den Markern eYFP (gelbgrün, Emissions- maximum bei 527 nm [Uni.Liv., 4.10.2012]) und pCherry21 (rot, Emissionsmaximum bei 610 nm [TSIEN, 2005]). Bei eYFP handelt es sich um ein hinsichtlich der Quantenausbeute und für die Expression in Säugerzellen optimiertes22 Derivat des GFP aus der Qualle Aequorea victoria, bei pCherry um eine optimierte Variante des DsRed aus einer Weichkoralle, Discosoma spec. Zwei Promotoren sorgen für die Ausbildung der Neomycin-, Kanamycin- und Geneticin-Kreuzresistenz in pro- und eukaryotischen Zellen, die auf den Resistenzgenen des Tn5-Transposons beruht [Clontech, 1999/2008]. Bei dem ORI für die bakterielle Replikation handelt es sich abermals um pUC.

2.2.1.3 pSuper

Der verwendete pSuper-Vektor stammt von OligoEngine, WA, USA.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 7. Der pSuper-Vektor ist optimiert für die Expression von shRNA. Abbildung aus [LAPTEVA, 2005], verändert.

Der pSuper-Vektor ist speziell für die Expression von shRNA in Säugerzellen entworfen. Für eine optimale Transkription der kurzen RNA-Stränge ohne Polyadenylierungs-Schwanz durch RNA- Polymerase III sorgt der H1 RNA-Genpromotor (Abbildung 7), welcher MCS vorgeschaltet ist [OligoEngine, o. J.]. Desweiteren verfügt der Vektor über einen pUC-ORI und das Gen für eine Ampicillin-Resistenz als Selektionsmarker, was es ermöglicht, den Vektor in Bakterien zu kopieren.

2.2.1.4 pLL3.7

Der LentiLox 3.7-Vektor wurde von LGC Standards GmbH, Wesel, bezogen.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 8. Plasmidkarte von pLentiLox 3.7 (pLL3.7). Abbildung aus [ScienceGateway, 10.9.2012], verändert.

Beim pLentiLox 3.7-Vektor (Abbildung 8) handelt es sich um ein Plasmid mit Sequenzabschnitten HI- viralen Ursprungs. Da in dem LentiLox-Plasmid jedoch mehrere, für die Replikation und Verpackung des Virusgenoms ins Capsid obligatorische Gene und regulatorische Sequenzabschnitte deletiert wurden, ist es selbständig nicht zur Vermehrung fähig [DULL, 1998; MIYOSHI, 1998; MIT CFCR, 4.10.2012]. Dafür trägt es einen pUC-Replikationsursprung für die Vervielfältigung in Bakterien sowie das Gen für eine Ampicillin-Resistenz23 als Selektionsmarker. Dazu verfügt der Vektor über das CMV-promovierte Gen für eGFP, sodass auch ein fluoreszenzbasierter Nachweis, dass das Plasmid aufgenommen wurde, möglich ist.

Die Klonierungsstelle für das shRNA-kodierende Oligonukleotid wird angeführt von einem Maus U6 RNA-Promotor (nach [YU, 2002]).

Der LentiLox-Vektor kann, wie die vorigen, mittels Lipofektion in seine Zielzellen transfiziert werden. Sein eigentlicher Vorteil besteht jedoch darin, dass es mithilfe einer Komplementation auch möglich ist, einmalig-infektiöse Viren herzustellen, Wirtszellen zu infizieren und so die DNA schonend zu transduzieren. Hierzu werden Wirtszellen mit pLentiLox und zusätzlichen Helfer-Plasmiden24 transfiziert. Auf diese Weise werden in den betroffenen Zellen auch die defizitären Informationen (Enzyme, Membran- und Capsidproteine) zur Herstellung der Viruspartikel separat zur Verfügung gestellt. Von der viralen RNA-Polymerase II wird dann das funktionelle Element des LentiLox-Plasmids, das von den beiden LTR25 flankiert wird, repliziert. Da nur dieses die Ψ-Signalsequenz besitzt, wird es als einzige mRNA zusammen mit den für die Infektion notwendigen Proteinen in die Virushülle verpackt. Nach Lyse der Wirtszellen und Aufreinigung des Lysats mit den Virionen können die Zielzellen, in die die genetische Information geschleust werden soll, infiziert werden.

Hierbei verschmelzen virale und Plasmamembran; das Capsid wird ins Cytoplasma entlassen, wo es seinen Inhalt (mRNA und Enzyme) freigibt [MODROW, Mol. Vir.]. Im Plasma wird die mRNA revers transkribiert und bildet einen Präintegrationskomplex [SUZUKI, 2007] mit für die Transposition wichtigen Enzymen, der die Kernhülle überwindet. Dort angekommen wird die cDNA in das Wirtsgenom integriert und die eingebrachten Zielgene exprimiert.

2.2.2 Wichtige Sequenzen

2.2.2.1 pSuper-Erkennungssequenzen

- pSuper PSD-95 KD

In nachfolgender Tabelle 1 ist die Sequenz an der Erkennungsstelle des pSuper PSD-95 KD- Konstrukts wiedergegeben. Zudem sind dort zum Vergleich die stillen Basenaustausche, die die RNAi-Resistenz der PSD-95 KDres-Variante bedingen, gekennzeichnet. Erstmals zum KD von PSD-95 verwendet wurde diese Sequenz von ELIAS et al., 2006.

Tabelle 1. Vergleich der Sequenzen von Wildtyp-PSD-95 und PSD-95 KDres in der Zielregion von pSuper PSD-95 KD. Farblich hervorgehoben sind die stillen Mutationen, die die KD-Resistenz hervorrufen.

Abbildung in dieser Leseprobe nicht enthalten

Diese 21 Nukleotide lange Erkennungssequenz liegt innerhalb der dritten PDZ-Domäne des PSD- 95 (vgl. Schema in Abbildung 4)

- pSuper eGFP

Das pSuper eGFP ruft den KD des Gens sowohl für das fluoreszierende Protein eGFP, als auch seines Derivats eYFP hervor, welches sich von eGFP nur in wenigen Basen unterscheidet.

Die Sequenz-Sonde (sense-Strang) des pSuper eGFP-Konstrukts, welche mit der mRNA des GFP hybridisiert, ist 19 Nukleotide lang.

Tabelle 2. Die Zielregion der shRNA aus pSuper eGFP.

Abbildung in dieser Leseprobe nicht enthalten

- pSuper Renilla

Das Konstrukt pSuper Renilla wurde für einen KD des Proteins Renilla-Luziferase entworfen.26 Auch die Sequenz-Sonde (sense-Strang) des pSuper Renilla-Konstrukts zur Erkennung der mRNA von Renilla-Luziferase ist 19 Nukleotide lang.

Tabelle 3. Die Zielregion der shRNA aus pSuper Renilla.

Abbildung in dieser Leseprobe nicht enthalten

2.2.2.2 Epitope

In den Versuchen wurden einesteils Vektoren mit speziellen Protein-Tags eingesetzt, die den Einsatz der wohlerprobten und handelsüblichen Antikörper αFLAG und αmyc ermöglichen. Hier sind die translatierten Oligopeptid-Sequenzen, welche von den Antikörpern erkannt werden, von N- nach C- terminal wiedergegeben.

- c-myc-Tag [HILPERT, 2001]: N—EQKLISEEDL—C
- FLAG-Tag [HOPPE, 1988]: N—DYKDDDDK—C

2.2.2.3 PCR-Primer

Für die PCR-Amplifikation eines Sequenzabschnitts wurden folgende Primer entworfen und durch BioTeZ Berlin Buch GmbH synthetisiert:

- NheI ratPSD-95 Vorwärts-Primer

5´ CCGCTAGCGCATGGACTGTCTCTGTATAG 3´

- EXFP-C1 Rückwärts-Primer

5´ AAACCTCCCACACCTCCCC 3´

2.2.2.4 Oligonukleotide

Um DNA herzustellen, die für shRNA zum KD von PSD-95 (Ratte) kodiert, wurden zwei einzelsträngige Oligonukleotide entworfen (Abbildung 9) und synthetisiert27. Das Design der Oligonukleotide folgt [UCSF, 15.5.2012].

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 9. Die entworfenen Oligonukleotide (rot; oben sense-, unten antisense-Strang) für die Hybridisierung der shDNA zum KD des nativen PSD-95 mit LentiLox-Vektoren. Der Überhang von 6 T über die funktionelle Sequenz (unten, schwarz) dient als Terminator für die RNA-Polymerase. Die zwei Stränge sind unterschiedlich lang, um am linken Ende eine glatte (HpaI-), am rechten eine Xho-Schnittstelle für die spätere Ligation zu simulieren.

Um die separat synthetisierten Einzelstränge zum Doppelstrang zu hybridisieren, wurden sie in Annealing-Puffer (nach [OligoEngine, o. J.]) kombiniert, erhitzt und langsam abgekühlt, s. u.

Annealing-Puffer:

- 100 mM NaCl
- 50 mM HEPES, pH 7.4

Für einen 50-µl-Ansatz werden dann je ein Mikroliter der auf gleiche Konzentrationen von 3 µg/µl eingestellten sense- und antisense-Oligonukleotide in 48 µl Annealing-Puffer gelöst.

Hybridisierungs-Prozedur:

1. Kochen im auf 95 °C vorgeheizten Thermomixer, 4 min
2. Überführung in zweiten Thermomixer auf 70 °C, 10 min
3. Thermomixer abschalten und langsam abkühlen auf 4 °C
4. Halten auf 4 °C, 10 min

2.3 Agarosegel-Elektrophorese

Zur größenabhängigen Auftrennung von DNA-Fragmenten wird eine Standard-Agarosegel-Elektrophorese eingesetzt. Dazu wird Wasser mit i. d. R.28 1 % (m/v) Agarose (SERVA Electrophoresis GmbH) aufgekocht, im Wasserbad unter Schwenken bis auf ca. 40 °C abgekühlt, dann 0.05 ‰ (v/v) Ethidiumbromid29 zugegeben, gemischt und zum Aushärten in Platten gegossen, wobei im Gel Taschen zum späteren Beladen mit der DNA-Probe ausgespart werden. Die Elektrophorese erfolgt in einer Elektrophoresekammer (Carl Roth) im TAE-Bad (1x), bei einer Spannung von meist 120 V. Die negativ geladene DNA wandert im elektrischen Feld Richtung Anode durch die Poren der Polysaccharid- Gelmatrix. Größere DNA-Fragmente werden dabei stärker zurückgehalten als kleine und wandern dementsprechend langsamer. Nach ausreichender Trennungszeit kann das Gel auf einem UV-Tisch begutachtet werden.

Soll ein auf diese Weise isoliertes DNA-Fragment – bspw. für einen folgenden Klonierungsschritt – aufgereinigt werden, so wird die entsprechende Bande im Gel mit einem Skalpell ausgeschnitten und nach Standardmethode [Eppendorf Gel Cleanup, 2002] aufgereinigt. Hierzu wird der Gelausschnitt unter externer Erwärmung in chaotroper Flüssigkeit gelöst, die DNA an die Glasfasermembran einer Trennsäule gebunden, mit Wasch-Puffer gewaschen und mit NF-Wasser eluiert [Eppendorf Gel Cleanup, 2002]. Bei Bedarf kann noch ein optionaler Konzentrationsschritt im Vakuum (Concentrator plus 5301, Eppendorf) folgen; in der Praxis erwiesen sich für 50 µl Elutionsvolumen 17 Min Laufzeit bei 45 °C als ideal.

2.4 Polymerase-Kettenreaktion (PCR)

Mittels PCR können kurze, genau definierte DNA-Abschnitte in vitro amplifiziert und, durch alternatives Primer-Design, modifiziert werden: Die aufgrund nichtkovalenter Wechselwirkungen aneinanderhaftenden Doppelstränge der zu amplifizierenden DNA werden dazu durch Erhitzen in wässriger Lösung getrennt. Beim Abkühlen hybridisieren die zugegebenen Primer, die Anfangs- und Endpunkt des amplifizierten Abschnitts markieren, mit der DNA. An ihnen setzt nun eine DNA- Polymerase an, die den fehlenden Strang ergänzt. Da die so wiederhergestellten Doppelstränge im nächsten Zyklus beide gespalten werden, können sie neuerlich als Matrize für die DNA-Polymerase fungieren, etc., weswegen man von einer Kettenreaktion spricht [SAMBROOK, Mol. Cloning].

Die PCR wurde in 50-µl-Ansätzen in einem Peltier Thermal Cycler 200 von GMI, Inc., MN, USA durchgeführt.

Allgemeines Pipettierschema (auf Eis):

- 5 µl OptiBuffer (BioLine)
- 1 µl MgCl2-Lsg.30, c = 100 mM
- 2.5 µl DMSO31 (≥ 99.5 % (v/v), Carl Roth)
- 1 µl dNTP (Gemisch der vier Desoxyribonukleotidtriphosphate der Nukleobasen, A:G:T:C = 1:1:1:1)
- 1 µl DNA-Matrize, c � 750 ng/µl
- 1 µl Vorwärts-Primer
- 1 µl Rückwärts-Primer
- 1 µl thermostabile BIO-X-ACT Long DNA Polymerase32 (BioLine)
- ad 50 µl H2O

Um eine vorzeitige Aktivität der DNA-Polymerase zu unterbinden, wird der PCR-Ansatz bis zum Beginn der PCR im Thermocycler auf Eis gehalten.

PCR-Zyklus

1. 2 min 95 °C, Schmelzen der DNA
2. ½ min 95 °C, Schmelzen der DNA
3. ½ min 53 °C, Hybridisierung der Primer
4. ½ min 72 °C, Elongation (� zurück zu Schritt 2, 34x)
5. 10 min 72 °C, Fertigsynthese angefangener Produkte
6. oo min 10 °C, Aufbewahrung bis auf weiteres

Während der 34 Zyklen wächst nur die Zahl der Fragmente richtiger Länge, d.h. derer, die von Vorwärts- und Rückwärts-Primer begrenzt werden, exponentiell. Die Zahl von 34 Zyklen stellt einen Kompromiss dar zwischen der Gewinnung einer möglichst hohen Menge an amplifizierter DNA und der Geringhaltung von zu kurzen PCR-Nebenprodukten, die durch zufälligen, verfrühten Replikationsabbruch entstehen und anschließend durch die Replikationsmaschinerie weiter kopiert werden.

Nach Abschluss des letzten Zyklus wird der PCR-Ansatz zur Aufreinigung einer Agarosegel- Elektrophorese mit anschließender Gel-Präparation unterzogen (s. Abschn. 2.3 , S. 21).

2.5 Klonierung

2.5.1 Restriktionsverdau

Das Schneiden von DNA mit Restriktionsendonukleasen erfolgte in 20-µl-Ansätzen in Eppendorf- Röhrchen. Zum Einsatz kamen dabei Restriktionsenzyme der FastDigest-Serie von Fermentas/Thermo Scientific.

Pipettierschema:

- 2 µl 10x FastDigest Green Buffer
- 1 bis 10 µl DNA (abhängig von Konzentration und Menge an vorhandener Probe)
- 0.5 µl FastDigest Restriktionsenzym
- (0.5 µl zweites FastDigest Restriktionsenzym, bei Doppelverdau)
- ad 20 µl H2O

In dieser Zusammensetzung wird der Ansatz dann für mindestens eine Stunde im Heizblock bei 37 °C verdaut.

2.5.2 Aufreinigung und Vorbereitung auf Ligation

Die Aufreinigung der so gewonnenen Fragmente erfolgt mittels Agarosegel-Elektrophorese und Gel- Präparation (s. Abschn. 2.3 ).

Danach kann die geschnittene DNA noch mit der alkalischen Phosphatase CIP behandelt werden, welche die Hydrolyse der Phosphatgruppen an den Nukleotiden der freien DNA-Enden katalysiert [SAMBROOK, Mol. Cloning]. Da die dephosphorylierten Enden sich untereinander nicht mehr ohne weiteres verbinden können, wird so eine Selbstligation nach dem Schnitt vermieden [ebd.].

2.5.3 Ligation

Geschnittene DNA-Fragmente können nun, sofern sie über kompatible Schnittstellen verfügen, neu kombiniert und ligiert werden. Die Ligation wird wiederum in einem 20-µl-Ansatz unter Einsatz des T4- Ligase-Systems33 von Fermentas durchgeführt.

Pipettierschema (auf Eis):

- 2 µl T4-DNA-Ligase-Puffer, 10x, Fermentas
- 2 bis 8 µl DNA Nr. 1 (je nach Konzentration und Menge an vorhandener Probe)
- 2 bis 8 µl DNA Nr. 2 (...)
- 1 µl T4-DNA-Ligase, Fermentas
- ad 20 µl H2O

Dieser Ansatz wird dann bei 4 °C über Nacht inkubiert. Danach kann, zur Kenntlichmachung der gelungenen Ligationen (bspw. mittels Resistenzmarkern) und Vermehrung der Konstrukte, die Transformation in Bakterien erfolgen.

2.6 DNA-Präparation und -Konzentrationsbestimmung

Der einfachste Weg, lange DNA-Abschnitte zu vervielfältigen, liegt in der Nutzung von Bakterien als Helferorganismen. In diesen wird plasmidäre DNA effizient vervielfältigt und kann anschließend geerntet werden.

2.6.1 Transformation

Einige Bakterienstämme wie etwa Bacillus-Spezies besitzen die genetische Ausstattung, um selbständig freie (normalerweise plasmidäre) DNA aus der Umwelt aufnehmen zu können. Diese Form des horizontalen Gentransfers bei Bakterien wird als Transformation, die Fähigkeit der Zellen dazu als Kompetenz bezeichnet [FUCHS, Allg. Mikrobiol.]. Bei manchen Bakterienspezies wie E. coli, die nicht von Natur aus kompetent sind, lässt sich der Zustand der Kompetenz künstlich herbeiführen, in unserem Falle nach der Calciumchlorid-Methode (modifizierte Standardmethode, nach HANAHAN, 1983). Hierfür werden in der logarithmischen Wachstumsphase befindliche Bakterien zunächst pelletiert. In welcher Wachstumsphase die Bakterien sich gerade befinden, wird i. d. R. über eine Messung der optischen Dichte der Zellsuspension bestimmt. Je höher die die Bakterienkonzentration und infolge derer die Lichtstreuung bei der Transmission der Lösung, desto eher treten die Bakterien bereits in die stationäre Phase ein. In der Praxis zeigt sich eine optische Dichte von 0.4 bis 0.6 (1 cm Küvetten-Kantenlänge, LB- Medium) als geeigneter Indikator für Bakterien in der log-Phase. Das Bakterienpellet wird bei 4 °C in 100 mM CaCl2 resuspendiert. Werden die Bakterien nach ca. zweistündiger Inkubation dann in 85 mM CaCl2-Lösung mit 15 % Glycerin aufgenommen, können sie bei -80 °C auch über längere Zeit gelagert werden, ohne ihre künstlich induzierte Kompetenz einzubüßen.

Der zu vervielfältigende DNA-Abschnitts wird zunächst in einen plasmidären Vektor kloniert, der als Selektionsmarker ein Antibiotikum-Resistenzgen trägt. Dieser Vektor wird den kompetenten Zellen in der Größenordnung von 50 bis einigen hundert Nanogramm DNA pro 50 µl Bakteriensuspension zugegeben und diese 30 min auf Eis inkubiert, woraufhin das Gemisch für 1½ min einem Hitzeschock von 42 °C unterzogen wird. Durch diese Behandlung werden die Plasmide in die Bakterien aufgenommen.34

Nach dem Hitzeschock werden die Bakterien für 60 min bei 37 °C inkubiert, während denen die positiv transformierten Bakterien die Resistenzgene exprimieren und ihre Antibiotikaresistenz ausbilden. Danach werden ca. 50 bis 100 µl der Bakteriensuspension auf einer LB-Platte mit dem Differenzierungs- Antibiotikum35 fraktioniert ausgestrichen, wo selektiv nur die positiven Transformanten überleben und Kolonien bilden.

Wurde das betreffende Fragment bereits in ein Plasmid kloniert, in E. coli transformiert und auf einer LB-Agarplatte mit Selektiv-Antibiotikum ausgestrichen, so kann nun eine Einzelkolonie steril gepickt, damit eine Mini-Kultur in 5 ml LB-Flüssig-Agar mit 1 ‰ Antibiotikum angeimpft und über Nacht im Schüttler bei 37 °C inkubiert.

2.6.2 Mini-Präparation

Für eine Mini-Präparation ist die in der Mini-Kultur enthaltene DNA-Menge bereits ausreichend. Die Bakterien werden zunächst pelletiert (6000xg, 15 min, 4 °C) und, dem Protokoll [QIAGEN Miniprep, 2009] folgend, resuspendiert. Nun folgt eine alkalische Lyse der Zellen. Nach spätestens 5 min wird die Lyse durch Neutralisation mit einem essigsäurehaltigen Puffer gestoppt, der zusätzlich SDS enthält. Wegen letzterem fallen Proteine, die Trümmer der Zellwand und -membran sowie mit ihnen die genomische Bakterien-DNA aus.36 Sie werden abfiltriert und der Überstand auf eine Trennsäule gegeben, an der die DNA gebunden wird. Dann wird die DNA mit speziellen Puffern von Rückständen gewaschen und schließlich mit NF-Wasser eluiert.

2.6.3 Maxi-Präparation

Für die Maxi-Präparation wird ca. 1 ml der Mini-Vorkultur entnommen und mit diesem eine Maxi- Kultur von 200 ml LB-Medium mit 1 ‰ Antibiotikum in einem Erlenmeyer-Kolben angeimpft und über Nacht im Schüttler bei 37 °C inkubiert. Am nächsten Tag werden die Bakterien abzentrifugiert (s. o.) und nach Protokoll [QUIAGEN Plasmid Kit, 2005] resuspendiert. Die Zellen werden alkalisch lysiert, die Lyse nach 5 min mit Acetat-Puffer gestoppt, der Niederschlag aus Proteinen und Zelltrümmern abzentrifugiert, der Überstand über eine Trennsäule geschickt und die DNA mit Wasch-Puffer gewaschen. Die DNA wird mit Wasser eluiert; nach Zugabe des 0.7-fachen Volumens an Isopropanol fällt sie aus und kann abzentrifugiert werden. Der Überstand wird verworfen, die DNA in 70%igem EtOH gewaschen, angetrocknet und schließlich in NF-Wasser aufgenommen.

2.6.4 Konzentrationsbestimmung

Die Konzentrationsbestimmung der DNA-Ausbeute erfolgt mithilfe des NanoDrop 1000 Spektralphoto- meters von Thermo Scientific. Mit diesem ist es möglich, die Konzentrationsmessung an Nukleinsäuren in extrem kleinen Probenvolumina (ab 1 µl) durchzuführen [TS NanoDrop, 2008].

Die Lichtabsorptionskurve von DNA zeigt bei einer Wellenlänge von 260 nm ein lokales Maximum [LOCKAU]. Diese Absorption wird gemessen und so intern mittels LAMBERT-BEER´schem Gesetz die DNA-Konzentration ermittelt. Zudem kann die Kontamination der DNA mit Fremdstoffen (z. B. Proteinen37 ) quantifiziert werden.

2.7 Transfektion

Möchte man in eukaryotischen Zellen die heterologe Expression eines Fremdgens beobachten, gilt es dieses zunächst in die Zelle einzuschleusen. Wird hierzu kein virales Übertragungssystem, sondern eine chemische (Calciumphosphat-Präzipitation, Transferrin, etc.), physikalische (Elektroporation, Mikro- injektion, etc.) oder Fusionsmethode (Lipofektion, Protoplastenfusion, etc.) genutzt, so spricht man von einer Transfektion [MÜHLHARDT, Mol./Gen.].

Bei den hier durchgeführten Experimenten wurde die Methode der Lipofektion für die Transfektion von COS-7-Zellen (und z. T. auch von Neuronen) angewandt. Speziell eingesetzt wurde Lipofectamine 2000 von Invitrogen. Hierbei handelt es sich um ein Gemisch diverser kationischer Lipide, die in wässriger Umgebung zu positiv geladenen Liposomen aggregieren. An diese Liposomen lagert sich die im vorherrschenden neutralen pH-Milieu38 negativ geladene, zu transfizierende DNA an [FELGNER, 1984]. Die Liposomen mit anhaftender exogener DNA fusionieren mit der Zellmembran der Zellen und entlassen die DNA ins Zellinnere.

Die COS-7-Zellen (idealerweise aus einer möglichst niedrigen Passage39 ) werden auf einer 12er Multiwell- Platte ausgesät und über Nacht im Brutschrank inkubiert. Im Versuch bewährt hat sich, was die Verträglichkeit der Transfektion für die Zellen anging, eine Zelldichte von 4·104 Zellen p. W. bei der Aussaat. Lebende COS-7-Zellen setzen sich danach wieder auf dem rauen Gefäßboden der Zellkulturplatte fest. Am nächsten Tag wird das alte COS-7-Zellmedium abgesaugt, die adhärenten COS- 7-Zellen mit 500 µl raumtemperiertem Opti-MEM bedeckt.

Das DNA-Lipofectamine-Gemisch besteht pro Well aus i. d. R. 0.4 µg DNA in 50 µl Opti-MEM (DNA- Mix) und 1 µl Lipofectamine in 50 µl Opti-MEM (Lipofectamine-Mix). Für den DNA-Mix ist hierbei zu beachten, dass im Falle einer Kotransfektion die verschiedenen DNA-Sorten schon vor der Zugabe zum Lipofectamine-Mix gemischt werden sollten; hierdurch wird gewährleistet, dass die Lipofectamine- Mizellen auch tatsächlich beiderlei Sorten an DNA enthalten. Der Lipofectamine-Mix ist im vorhinein zu verdünnen, da reines Lipofectamine an die Gefäßwand von Kunststoffröhrchen adhärieren kann. Nachdem DNA- und Lipofectamine-Mix separat gevortext, 5 min stehengelassen und dann zusammen- gemischt worden sind, folgt eine 20minütige Inkubation, während derer die Lipide weiter aggregieren können und die DNA sich anlagert, bevor der fertige Mix (je 100 µl DNA-Lipofectamine-Gemisch p. W.) zu den Zellen gegeben wird. Danach werden die Zellen über eine weitere Nacht im Brutschrank inkubiert.

Am darauffolgenden Tag erfolgt die Ernte der transfizierten Zellen. Hierzu wird das Nährmedium entfernt, die Zellen einmal mit DPBS gewaschen und für 5 min bei 37 °C mit 200 µl Trypsin p. W. inkubiert. Dann werden die Zellen aus den Wells in Eppendorf-Mikrozentrifugenröhrchen mit 800 µl 10%igem FCS in DPBS überführt, wodurch das Trypsin inaktiviert wird.

Nach der Ernte der Zellen sollte möglichst zügig deren weitere Analyse mittels WB oder Durchflusszytometrie erfolgen, um einsetzenden Abbauprozessen, etc., die die Ergebnisse verfälschen könnten, vorzubeugen.

2.8 SDS-PAGE

Soll bspw. die Expression eines in COS-7-Zellen transfizierten Gens über einen WB nachgewiesen werden, so werden die Zellen nach der Ernte (s. Abschn. 2.7 ) in Eppendorf-Röhrchen überführt, bei 2500 rpm 5 min lang zentrifugiert, der Überstand verworfen, das Pellet hingegen in 100 µl SDS-PAGE- Puffer40 resuspendiert und 5 min auf 95 °C erhitzt. Der resultierende denaturierte Zustand der Proteine erlaubt eine Auftrennung der enthaltenen Proteine gemäß ihrer Molekülmasse [STRYER et al., Biochemie], da die Proteine so sequenzunabhängig eine rundliche Form annehmen, deren Radius (und damit die Wanderungsgeschwindigkeit in der Gelmatrix) mit der Molekülmasse korreliert ist.

Von den so aufbereiteten Zelllysaten wurden nun i. d. R. je 15 µl pro Spur auf zumeist 10%igen Acrylamidgelen (s. u.) geladen, zusammen mit 10 µl Größenmarker (Kaleidoscope Protein Standard von Bio-Rad).

Pro Gel-Gussform wurde für 10%iges Polyacrylamidgel eingesetzt:

Trenngel: 1.9 ml H2O, 1.7 ml 30%ige Acrylamidlösung (Carl Roth GmbH, Karlsruhe), 1.3 ml TRIS (= Tris(hydroxymethyl)-aminomethan)-Puffer 1, 50 µl 10%iges SDS, 100 µl 10%iges Ammonium- peroxodisulfat (APS, Carl Roth) als Radikalstarter, 2 µl 99%iges TEMED (= N,N,N´,N´-(Tetramethyl)- ethylendiamin, Carl Roth) als Polymerisationskatalysator.

Sammelgel: 680 µl H2O, 170 µl Acrylamidlösung (30 %), 130 µl TRIS-Puffer 2, 10 µl SDS (10 %), 10 µl APS (10 %), 1 µl TEMED.

In einer mit LAEMMLI-Puffer befüllten Gelelektrophoresekammer (Bio-Rad) folgt die elektrophoretische Trennung: Die auf das Protein im elektrischen Feld wirkende Coulomb-Kraft ist abhängig von dessen vor allem in Form von SDS anhaftender Ladung, welche der Peptidkettenlänge und damit der Proteinmasse direkt proportional ist. Dieser Feldbeschleunigung entgegen steht die kurze freie Weglänge im PAG, welche für Proteine mit größerem Volumen immer weiter abnimmt. So kommt es schnell zur Einstellung von Gleichgewichtsgeschwindigkeiten, die für kleinere Proteine höher sind als für große. Daher zeigen verschiedene Proteine im angelegten elektrischen Feld ein nichtlineares Aufspaltungsverhalten [SAMBROOK, Mol. Cloning]. Eine Erhöhung der PA-Konzentration senkt die mittlere freie Weglänge im Gel, was eine niedrigere Wanderungsgeschwindigkeit für alle Proteine zur Folge hat.

Konkret eingesetzt wurde eine zunächst niedrige Spannung von 30 V, bis die Lauffront der Proteine41 aus dem Sammelgel ins Trenngel getreten war; dann wurde die Spannung auf 150 V erhöht und gehalten, bis die Lauffront auch das Trenngel verließ. Zu diesem Zeitpunkt war meistens bereits eine ausreichende Trennung erreicht.

2.9 Western Blotting

2.9.1 Vorgehen

Die in der SDS-PAGE aufgetrennten Proteinbanden im Gel werden nun nach dem Western Blotting- Verfahren elektrophoretisch auf eine Membran aus Poly-Vinylidenflourid (PVDF, 0.45 µm Porengröße, von Hoffmann-La Roche, CH) übertragen. Ihre exponierte Lage auf der Membran macht die Proteine für Antikörper leicht zugänglich [MÜHLHARDT, Mol./Gen]. Auf diese Weise können die Proteine von Interesse spezifisch immunomarkiert und sowohl ihre Menge, als auch ihr Ort auf der Membran (d. h. ihre Größe) sichtbar gemacht werden.

Um die PVDF-Membran vor ihrem Einsatz mit dem Blotting-Puffer äquilibrieren zu können, muss die trockene Membran aufgrund ihrer hohen Hydrophobizität zunächst einige Sekunden in MeOH gebadet und mit Wasser gespült werden.

Das hohe Proteinbindungsvermögen, das die PVDF-Membranen für ihren Einsatz auszeichnet, beruht auf hydrophoben Wechselwirkungen mit lipophilen Proteinbestandteilen [Roche PVDF, 2011]. Auf einer nicht weiter behandelten Membran würden diese dazu führen, dass auch die eingesetzten Antikörperproteine an noch vorhandene, freie Bindungsstellen gebunden würden. Das macht es notwendig, die noch unbesetzten, unspezifischen Bindungsstellen auf der Membran zunächst mit anderen Proteinen abzusättigen, die die weitere Analyse nicht beeinträchtigen. Dies wird durch eine Behandlung mit einer 5%igen (m/v), wässrigen Lösung von entfettetem Milcheiweiß42 (Carl Roth) erreicht. Dazu wird die Milch mit der geblotteten Membran in einem 50 ml Falcon-Tube 1 h bei 4 °C auf einem Rollmixer inkubiert, welcher garantiert, dass die Membran stetig und gleichmäßig von der Flüssigkeit benetzt ist. Danach kann die Blocklösung verworfen und dem Tube der primäre Antikörper43 in 5 ml Milch zugegeben werden. So wird das Tube über Nacht auf dem Rollmixer bei 4 °C inkubiert. Derweil können die Antikörper an ihre Epitope binden.

Am nächsten Tag folgt, nach drei zehnminütigen Waschschritten in PBST, die Inkubation mit dem sekundären Antikörper, αprimär-HRP. Bei diesem handelt es sich um ein Fusionsprotein, bei welchem ein Antikörper gegen die konstante Domäne des primären Antikörpers mit Meerrettichperoxidase (HRP) gekoppelt ist. Inkubiert wird wiederum in 5 ml Milch bei 4 °C für eine Stunde auf dem Rollmixer. Danach wird der Blot erneut dreimal in PBST gewaschen.

Zur Entwicklung des Western Blots wird die Membran in einer Photokassette mit ca. 300 µl einer Mischung aus gleichen Anteilen Oxidizing Reagent und Enhanced Luminol (beide aus der Western Lightning Plus-Reihe von PerkinElmer, MA, USA) benetzt und zwischen zwei transparente OHP-Folien eingebettet.

Das Prinzip der Luminol-Chemolumineszenz besteht darin, dass das Luminol (3-Aminophtalsäure- hydrazid) im basischen Milieu im chemischen Gleichgewicht mit einem Dianion steht, welches mit Sauerstoff zu einem instabilen Peroxidanion reagiert. Dieses zerfällt unter Abspaltung von molekularem Stickstoff in ein angeregtes Aminophtalat-Dianion, welches bei seinem Übergang in den Grundzustand ein Photon aus dem blauen Lichtspektrum freisetzt [MERÉNYI, 1990]. Auf dem Blot katalysiert die Meerrettichperoxidase die Bildung von Sauerstoff44, sodass es nur an den Stellen, an denen der sekundäre Antikörper gebunden hat, zu einer wesentlichen Lichtentwicklung kommt.

Diese Lichtentwicklung wird mit einem photosensitiven Film (GE Amersham Hyperfilm ECL) ortstreu in der Photokassette registriert. Durch die Fähigkeit des antikörpergebundenen HRP-Katalysators, viele Substratmoleküle umsetzen können und dadurch die Chemolumineszenz zu aktivieren, sowie der zeitlichen Integration des Signals auf dem Photofilm können noch sehr geringe Konzentrationen an Antikörper-HRP-Konjugaten bis in den Bereich von Pikogramm nachgewiesen werden [PerkinElmer, o. J.].

2.9.2 Antikörper

Für einen erfolgreichen Nachweis von PSD-95 im Western Blot sind verlässlich funktionierende Antikörper ausschlaggebend. Da zu Anfang mehrere prinzipielle Kandidaten für Antikörper zur Verfügung standen, die sich in Epitop, Herkunftsorganismus und/oder Hersteller unterschieden, wurden sie zunächst auf ihre spezifischen Vor- und Nachteile untersucht, um nachher die optimalen Antikörper für die jeweilige Testsituation auszuwählen.

Zum einen standen dazu Antikörper zur Verfügung, die eine direkte Spezifität auf PSD-95 zeigen (von Stressgen bzw. NeuroMab, beide aus Maus), ein FLAG-Antikörper (Maus) für den Einsatz von PSD-95 mit anhängendem FLAG-Tag sowie ein Antikörper (aus Kaninchen) gegen das Fluoreszenzprotein pCherry, das im pCherry-N1- und LentiLox-Konstrukt mit PSD-95 fusioniert ist. Zudem ein Antikörper gegen Tubulin zur Durchführung von Ladungskontrollen auf dem WB.

- αTubulin (Ratte)

Tubuline (ca. 55 kDa schwer45 ) kommen als Bestandteil des Zytoskeletts in eukaryotischen Zellen vor und werden dort relativ gleichmäßig exprimiert. Deswegen eignen sie sich im WB als Ladungskontrolle. Dazu wird die WB-Membran mit einen zweiten primären Antikörper inkubiert, der ein Tubulin als Antigen besitzt. Sind nach der Entwicklung alle Tubulin-Banden gleich stark, kann davon ausgegangen werden, dass in allen Spuren in etwa dieselbe Menge an Lysat geladen wurde. Konkret verwendet wurde der Antikörper YL1/2 von Abcam plc, UK46.

- αPSD-95 (Maus, Stressgen Bioreagents, BE)

Der PSD-95-Antikörper von Stressgen arbeitete im allgemeinen sehr zufriedenstellend. Endogenes und überexprimiertes PSD-95 wurde zuverlässig erkannt; auch anheftende Tags wie FLAG oder myc stören die Antikörperbindung nicht (Abbildung 10).

Auch eine hohe Spezifität des PSD-95-Antikörpers muss konstatiert werden. Selbst DLG3, ein dem PSD-95 eng verwandtes neuronales Gerüstprotein mit weitgehend analogem Aufbau47 wird vom Stressgen-Antikörper nicht gebunden.

Bei einem Vergleich mit Empfindlichkeiten anderer Antikörper konnte festgestellt werden, dass mit dem Stressgen-Antikörper zwar noch relativ geringe Konzentrationen an PSD-95 nachgewiesen werden können, die Empfindlichkeit z. B. des FLAG-Antikörpers (bei FLAG- getagten PSD-95-Varianten) jedoch nicht erreicht wird (vgl. Abbildung 18, S. 39).

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 10. Mit PSD-95 (Stressgen) inkubierter WB von PSD-95-FLAG und PSD-95-myc im pCMV-Tag- Vektor, untransfizierten COS-7-Zellen und murinem Hirnlysat. Man beachte die starke Ausprägung der PSD-95- Bande im Hirnlysat, die für eine hohe Abundanz des Proteins im Hirngewebe spricht.

- αPSD-95 (Maus, NeuroMab)

Mit dem monoklonalen PSD-95-Antikörper von NeuroMab (UC Davis/NIH NeuroMab Facility, CA, USA) konnten nach demselben Blotting-Protokoll keine vergleichbar guten Resultate erzielt werden wie mit dem Pendant von Stressgen, was sich in schmierigen und undifferenzierten Banden zeigte.48

- αpCherry (Kaninchen)

Manche der klonierten Knockdown-Konstrukte tragen ein rot fluoreszierendes pCherry- Anhängsel, das es ermöglicht, die Expression des Fusionsproteins fluoreszenzmikroskopisch oder im durchflusszytometrisch nachzuweisen. Es eröffnet aber auch die Möglichkeit, das Fusionsprotein im WB mithilfe eines Antikörpers gegen pCherry (aus Kaninchen, polyklonal, von Clontech, Inc., CA, USA) nachzuweisen.

Es zeigte sich, dass man mit dem pCherry-Antikörper bei gleichem Anwendungsschema (Konzentrationen, etc.) wie bei dem PSD-95-Antikörper von Stressgen vergleichbar gute und, darüberhinaus, konsistente Ergebnisse erzielen kann.

2.9.3 Selektivität des Knockdown – Positiv- und Negativ-Kontrollen

Für den Nachweis des Knockdown der PSD-95-Expression mithilfe der entworfenen pSuper-Konstrukte, welche auf RNA-Interferenz mit einem Sequenzabschnitt in der 3. PDZ-Domäne des PSD-95 abzielen (kurz: „pSuper PSD-95 KD“), wird das pSuper-Plasmid zusammen mit verschiedenen PSD-95- Konstrukten in COS-7-Zellen kotransfiziert. Kotransfektionen mit anderen Konstrukten dienen als Kontrollen für die gewonnenen Ergebnisse. Je nachdem, ob das jeweilige Kontrollkonstrukt eine theoretische KD-Funktion haben sollte oder nicht, können die Banden der Positiv- und Negativ- Kontrollen mit dem PSD-95-KD verglichen und dieser so interpretiert werden.

Als Negativ-Kontrollen werden vornehmlich pSuper Renilla sowie pSuper eGFP (im Falle von PSD-95- Konstrukten ohne Fluoreszenzmarker, z. B. in pCMV-Tag) eingesetzt.

Bei PSD-95 lösen hingegen weder pSuper Renilla, noch pSuper eGFP eine RNA-Interferenz hervor, da die von ihnen kodierten shRNAs nicht in der Lage sind, mit der mRNA von PSD-95 zu hybridisieren.

In einem entsprechend gewählten Versuchsansatz kann pSuper eGFP zudem auch als Positiv-Kontrolle dienen, wenn nämlich das PSD-95 in Form eines fluoreszenzmarkierten Fusionsproteins transfiziert wird. Die shRNA lagert sich dann an seine Erkennungssequenz innerhalb des eGFP-mRNA-Abschnitts an und initiiert den Abbau der kompletten mRNA des Fusionsproteins.

2.10 Fluoreszenz-Mikroskopie

Die fluoreszenzmikroskopischen Untersuchungen werden an einem inversen Phasenkontrastmikroskop vom Typ Leica DM IL LED mit externer UV-Kaltlichtquelle durchgeführt. Die Kaltlichtquelle (Leica EL 6000) liefert intensives Weißlicht mit einem hohen Anteil im ultravioletten Spektralbereich49, das sich für die Exzitation von GFP-Molekülen und deren Derivaten eignet. Das Mikroskop wiederum verfügt über interne Farbfilter, die zwar die rotverschobene Fluoreszenz der Fluorophore, nicht jedoch das Anregungslicht selbst passieren lassen.

Mithilfe dieser Geräte können lebende Zellkulturen schonend auf die Expression von fluoreszenten Proteinen wie eGFP, eYFP oder pCherry hin untersucht werden.

Koppelt man die fluoreszenten Proteine an PSD-95-Varianten, kann auch die Expression des Fusionsproteins und (damit indirekt des PSD-95) mittels eines Lichtmikroskops erfolgen.

So konnte etwa die Expression von mithilfe des pEYFP-N1-Vektor in COS-7-Zellen transfiziertem PSD- 95 in Form von gelblich-grün fluoreszierende Zellen in vitro gezeigt werden. Je nachdem, ob die Transfektion bei den einzelnen Zellen mehr oder weniger erfolgreich verlaufen war, zeigten diese individuelle Intensitätsschwankungen der allgemein deutlichen ausgeprägten Fluoreszenz. Diese generell starke Fluoreszenz ist zum einen sicher auf den CM-viralen Promotor zurückzuführen, der im Allgemeinen eine sehr starke Expression hervorruft [FOECKING, 1986], zum anderen bestimmt auch auf die hohe Güte des Fluorophors eYFP.

Ästhetisch besonders eindrucksvoll war die Mikroskopie von mit PSD-95-eYFP transfizierten Neuronen, bei denen die Fluoreszenz des überexprimierten Fluorophors die filigrane Zellform erst in vollem Ausmaß zur Geltung brachte und die Dendriten bis in die feinen Äste sichtbar machte.

2.11 Durchflusszytometrie

Für die durchflusszytometrische Analyse von mit Fluorophoren transfizierten Zellen wurde ein FACSCalibur flow cytometer von BD Biosciences eingesetzt.

Die zu analysierenden Zellproben werden nach der Transfektion geerntet und möglichst zeitnah mit dem Durchflusszytometer auf ihre Fluoreszenz untersucht. Hierbei werden die Zellen durch eine Glaskapillare gesaugt und dabei von einem Anregungslaser50 bestrahlt. Der Durchmesser der Kapillare ist so gering bemessen, dass sie nur von einzelnen Zellen nacheinander passiert werden kann, was die sequentielle Analyse einzelner Zellen ermöglicht.

Über die Streueigenschaften einer Zelle im Strahlengang (Winkelabhängigkeit der Reflexe, etc.) wird Information über die Zellform gewonnen. Anomale Zellformen sind meist Anzeichen für einen allgemein schlechten Gesundheitszustand der Zelle. Über eine Vorauswahl wird festgelegt, welche Zellformparameter tolerabel sind; auf diese Weise kann aktiv gewährleistet werden, dass nur die Fluoreszenz gesunder Zellen in die statistische Analyse eingeht.

Im gestreuten Licht wird dann der Anteil an Fluoreszenzlicht bestimmt, welches im Vergleich zum Anregungslaser zum roten Ende des Spektrums hin verschoben ist.

Da mit dem Durchflusszytometer dergestalt schnell die Fluoreszenzeigenschaften großer Populationen von (typischerweise mehreren Tausend) Zellen gemessen werden können, ist diese Technik prädestiniert für die Gewinnung statistisch repräsentativer und quantitativ aussagekräftigerer Ergebnisse als bspw. über den klassischen Western Blot.

§ 3 Vorgehen und Ergebnisse

3.1 Klonierungs- und Arbeitsschritte bis zu den fertigen Konstrukten

3.1.1 pCMV-Tag 2A PSD-95 KDres

Weitere Klonierungen sollten von einem von N. Rademacher modifizierten pCMV-Tag PSD-95- Konstrukt ausgehen. Dabei handelt es sich um einen pCMV-Tag 2A-Vektor, welcher in seiner MCS die Sequenz für eine PSD-95-Variante trägt, die gegenüber dem Wildtyp-PSD-95 mithilfe von stillen Punktmutationen (vgl. Tabelle 1) gezielt so abgeändert wurde, dass ihre mRNA vom RNA- Interferenzmechanismus des pSuper PSD-95 KD-Konstrukts nicht erkannt wird. Die modifizierte Variante soll hier daher als Knockdown-resistent (KDres) bezeichnet werden.

Eine Kontrollsequenzierung51 zeigte, dass es im ORF dieses Ausgangskonstrukts zu einer Punktmutation gekommen war (in Abbildung 11 markiert durch schwarzes „X“). Solch ein Basenaustausch muss nicht per se Auswirkungen auf die Proteinfunktion haben; um sie jedoch völlig ausschließen und die Vergleichbarkeit und nötige Aussagekraft von Ergebnissen wiederherzustellen, sollte die Punktmutation revidiert werden. Dazu wurde der KDres-Sequenzabschnitt, die Mutation außen vor lassend, mit BamHI ausgeschnitten (vgl. Doppelschnittstelle in Abbildung 11), auf einem 1%igen Agarosegel vom Rückgrat getrennt und aufgereinigt.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 11. Die singuläre EcoRI- und SalI-, sowie die doppelte BamHI-Schnittstelle im pCMV-Tag PSD- 95 KDres-Vektor. Vor dem PSD-95 im selben ORF ist das FLAG-Tag zu sehen. Unterhalb in rot der Sequenz- abschnitt in der 3. PDZ-Domäne, welcher normalerweise von pSuper PSD-95 KD erkannt wird (vgl. Tabelle 1, S. 19) und der in unserem Fall durch Wobble-Austausche modifiziert ist. Das schwarze „X“ markiert die Stelle des zu behebenden Basenaustauschs. Die Zahlen geben die Nummerierung der Basenpaare wieder.

Ebenso wurde das Rückgrat eines intakten Wildtyp-PSD-95 im pCMV-Tag-Vektor mit BamHI verdaut und isoliert. Die Insertion des Knockdown-resistenten Sequenzabschnitts ins Rückgrat erfolgte nach Standardprotokoll (Abschn. 2.5.3 , S. 24). Die Ligationsprodukte wurden in E. coli TOP10 transformiert, die Bakterien anschließend auf Kan-LB-Agarplatten ausgestrichen. Von den gewachsenen Kolonien wurden zunächst 6 Klone gepickt und minipräpariert. Unter diesen war, wie ein Kontrollverdau mit EcoRI und SalI zeigte, nur ein Plasmid, welches das Insert tatsächlich enthielt (Abbildung 12).

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 12. Kontrollverdau der Mini-Präparationen sechser mit den Ligationsprodukten transformierter Kolonien (EcoRI und SalI), elektrophoretisch aufgetrennt auf einem 1%igen Agarosegel. Nur Klon K6 zeigt das Plasmid mit dem gewünschten Insert.

Eine anschließende Kontrollsequenzierung konnte zeigen, dass das ausgeschnittene Fragment in der richtigen Orientierung in das neue Rückgrat inseriert worden war.

3.1.2 pEYFP-N1 PSD-95 KDres und pCherry-N1 PSD-95 KDres

Auch die Konstrukte pEYFP-N1 PSD-95 KDres und pCherry-N1 PSD-95 KDres tragen die Sequenz der KD-resistenten PSD-95-Variante, allerdings mit einem anhängenden Fluoreszenzprotein (eYFP bzw. pCherry).

Zur ihrer Herstellung wurde der pCMV-Tag PSD-95 KDres-Vektor mit den Restriktionsenzymen EcoRI und SalI verdaut (vgl. Abbildung 11), das Insert elektrophoretisch auf einem 1%igem Agarosegel vom Rückgrat getrennt und aufgereinigt. Parallel wurden die Vektoren pEYFP-N1 PSD-95 WT und pCherry- N1 PSD-95 WT mit EcoRI sowie SalI geschnitten (vgl. Abb. unten), deren Rückgrate isoliert, das WT- Insert verworfen. Das aufgereinigte KDres-Insert aus dem pCMV-Tag-Vektor wurde dann entweder mit dem pEYFP-N1- oder dem pCherry-N1-Rückgrat gemischt und direkt52 nach Standardverfahren über Nacht ligiert.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 13. Die Schnittstellen von EcoRI, SalI, XhoI und BsrGI im pCherry-N1 PSD-95 WT-Vektor. Rot der Sequenzabschnitt, der von pSuper PSD-95 KD erkannt wird. Das Wildtyp-PSD-95 wurde dann mithilfe von EcoRI und SalI aus dem N1-Vektor ausgeschnitten und durch die KDres-Variante aus dem pCMV-Tag-Vektor (Abbildung 11) ersetzt.

Am nächsten Tag wurden die Ligationsprodukte in E. coli TOP10 transformiert, auf Kan-LB-Platten ausgestrichen und bei 37 °C über Nacht inkubiert. Tags darauf wurden von den gewachsenen Kolonien 10 Klone gepickt und Mini-Kulturen (LB, 1 ‰ (v/v) Kan) angeimpft.

Nach Wachstum über Nacht bei 37 °C wurden die Mini-Kulturen präpariert und die Plasmid-DNA in 50 µl NF-Wasser aufgenommen, wovon zur Überprüfung, ob das Insert tatsächlich eingebaut worden war, 1 µl mit XhoI und SalI verdaut und über einem 1%-Agarosegel aufgetrennt wurde. In Abbildung 14 ist exemplarisch das Ergebnis der Agarosegel-Elektrophorese für je eine Mini-Präparation mit (K1), sowie ohne PSD-95 KDres-pCherry-Insert (K2) gezeigt.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 14. Der Verdau zweier transformierter Mini-Kulturen der Ligation von PSD-95 KDres im pCherry-N1- Rückgrat, aufgetrennt auf einem 1%igen Agarosegel. Das Plasmid aus Kolonie K1 trug das Insert, das aus K2 hingegen nicht.

3.1.3 Einbau NheI-Schnittstelle

Das langfristige Ziel ist es, einen lentiviralen Vektor herzustellen, der in Zellen endogenes WT-PSD-95 stillzulegen und stattdessen Knockdown-resistentes PDS-95 KDres überzuexprimieren. Dazu wird die Strategie verfolgt, das PSD-95 KDres-Fragment zusammen mit den Fluorophor-Tags aus dem pCherry- N1- sowie dem eYFP-N1-Vektor auszuschneiden und anstelle des eGFP in das LentiLox-Plasmid (s. Abbildung 8, S. 18, sowie Abbildung 16, S. 37) einzusetzen. Hierzu kommt ein Verdau mit EcoRI und NheI infrage.

In das LentiLox-Plasmid mit PSD-95 KDres-pCherry-Konstrukt soll danach mithilfe von HpaI und XhoI noch das PSD-95 KD-Duplex eingebaut werden können (hinter dem Maus-U6-Promotor, Abbildung 8). Würde nun einfach das pCherry-PSD-95 KDres-Insert aus dem pCherry-N1-Vektor mit EcoRI und NheI ausgeschnitten und in das LentiLox-Plasmid inseriert, brächte man damit, wie man in Abbildung 12 sieht, eine zweite XhoI-Schnittstelle ins Plasmid ein. Das würde beim anschließenden Versuch, das PSD- 95 KD-Duplex unter Verdau mit XhoI einzubauen, zu einem Stückverlust führen.

Deswegen wurden zwei Primer entworfen (s. Abschn. Error! Reference source not found., S. Error! Bookmark not defined.), um mittels PCR eine neue NheI-Schnittstelle direkt vor das 5´-Ende der pCherry-PSD-95 KDres-Sequenz anzuheften.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 15 Das PCR-amplifizierte Insert. Vergrößert dargestellt sind die beiden Enden mit den jeweiligen Primern (grün).

Das in Abbildung 15 gezeigte, ca. 3 kBp lange Fragment wurde in PCR-Standardeinstellungen (s. Abschn. 2.4 , S. 22) amplifiziert, auf einem 1%igen Agarosegel von den unerwünschten PCR-Neben- produkten getrennt, aufgereinigt und in NF-Wasser aufgenommen.

3.1.4 Insertion in pLentiLox 3.7

Die mittels PCR amplifizierte PSD-95 KDres-pCherry-Sequenz ohne XhoI-Schnittstelle sollte nun in das LentiLox-Rückgrat inseriert werden.

Hierzu wurde sowohl das LentiLox-Plasmid, als auch das PCR-Amplifikat mit den Restriktionsendo- nukleasen NheI und BsrGI geschnitten (s. Schnittstellen in Abbildung 8 bzw. Abbildung 15) und auf einem 1%-Agarosegel aufgetrennt. Die relevanten Fragmente wurden aufgereinigt, nach Standard- protokoll ligiert, in E. coli str. Stbl2 transformiert, auf einer Amp-LB-Platte ausgestrichen und bei RT mehrere Tage bebrütet.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 16. Das klonierte Insert im LentiLox-Plasmid. Wichtige Sequenzabschnitte sind (v.l.n.r.): Der 5´-LTR- Bereich des HIV-1, der Maus U6-Promotor, der später die shRNA für den KD promovieren soll und den CMV- Promotor für die Expression des stromabwärtsliegenden ORF von PSD-95 KDres-pCherry. Ganz rechts der 3´-LTR- Bereich von HIV-1 (vgl. auch Abbildung 8).

Von den gewachsenen, positiv transformierten Kolonien wurden Klone gepickt und Mini-Kulturen in LB- Medium mit 1 ‰ (v/v) Ampicillin angesetzt. Nach Mini-Präparation der Kulturen wurde jeweils 1 µl der DNA mit NheI und BsrGI verdaut und auf das Vorhandensein des Inserts überprüft. Abbildung 17 zeigt den ausführlichen Kontrollverdau eines LentiLox-Plasmids mit inseriertem PSD-95 KDres-pCherry (Spur 1). Deutlich ist im Vergleich zum mitverdauten, leeren LentiLox-Plasmid (Spur 2) die Insert- Bande zu erkennen. Außerdem läuft die Insert-Bande auf derselben Höhe wie das PSD-95 KDres- Fragment, das aus einem pCherry-N1-Vektor ausgeschnitten wurde (Spur 3) – Indizien für einen korrekten Einbau des Inserts.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 17. Agarosegel des Parallelverdaus von pLL3.7 PSD-95 KDres-pCherry sowie Negativ- und Positiv- Kontrolle mit NheI und BsrGI. In den Spuren sind v.l.n.r. gelaufen: LentiLox mit PSD-95 KDres-pCherry-Insert (1), leeres LentiLox-Plasmid (2) sowie pCherry-N1 mit PSD-95 KDres-Insert (3).

Eine anschließende Sequenzanalyse des LentiLox-Plasmids mit pCherry konnte die gewünschte Sequenz bestätigen.

3.2 Nachweis für Expression und Knockdown im WB

Zum Vergleich der KD-Effektivität und -Selektivität des pSuper PSD-95 KD-Konstrukts wurde die Protein-Expression über einen WB analysiert.

Transfiziert wurden der Wildtyp-PSD-95, die zur Knockdown-Resistenz modifizierte Variante PSD- 95 KDres und, als Negativ-Kontrolle, DLG3, jeweils im pCMV-Tag-Vektor in COS-7-Zellen. Durch die Wahl des pCMV-Tag-Vektors tragen diese Konstrukte allesamt ein FLAG-Tag und können mithilfe des aFLAG-Antikörpers nachgewiesen werden.

Zusätzlich wurden, in allen möglichen Permutationen, das Knockdown-Konstrukt pSuper PSD-95 KD sowie, als negative (non-silencing) Kontrollen, pSuper eGFP und pSuper Renilla kotransfiziert. Die non- silencing-Kontrollen verursachen keinen Abbau der mRNA von PSD-95, der ähnliche Transfektionsstress und mögliche gleichzeitige Nebeneffekte des pSuper-Plasmids gewährleisten aber die Vergleichbarkeit mit dem PSD-95-Knockdown.

Der Zellen wurden nach Protokoll geerntet, einer SDS-PAGE unterzogen und auf PVDF-Membran geblottet. Diese wurde dann zunächst mit aPSD-95 (Maus, Stressgen) als primärem, aMaus-HRP als sekundärem Antikörper inkubiert und der Blot auf Photofilm entwickelt, um die Expression von PSD-95 nachzuweisen. Anschließend wurde, zur Kontrolle und Sichtbarmachung der DLG3-Banden, der Blot in zwei Schritten mit aFLAG (Maus) sowie aMaus-HRP und, als Ladungskontrolle, aTubulin (Ratte) sowie aRatte-HRP inkubiert und der Blot erneut entwickelt. Das Ergebnis ist in Abbildung 18 gezeigt.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 18. Vergleich der Effizienz des Knockdown von PSD-95 WT gegenüber PSD-95 KDres und DLG3 (Negativ-Kontrolle). Knockdown mithilfe des pSuper PSD-95 KD-Konstrukts; als non-silencing-Kontrollen dienen pSuper eGFP und pSuper Renilla. Die PSD-95-Bande wurde oben entwickelt mit αPSD-95, unten mit αFLAG als primärem Antikörper. Ladungskontrolle mit αTubulin.

Die überall gleichstark ausgeprägte Tubulin-Bande belegt, dass in allen Spuren gleichviel Lysat geladen wurde. Die Entwicklung mit FLAG-Antikörper zeigt, dass auch das vom PSD-95-Antikörper nicht erkannte DLG3 in den damit transfizierten COS-7-Zellen stark exprimiert wird.

Bemerkenswert ist das atypische Wanderungsverhalten der beiden Proteine: DLG3, obwohl das größere und schwerere Protein, läuft leicht unterhalb von PSD-95.

Effektivität und Selektivität des Knockdown:

Wie man in Abbildung 18 erkennt, ist in Zellen, die mit Wildtyp-PSD-95 in Kombination mit pSuper PSD-95 kotransfiziert wurden, wesentlich weniger PSD-95 vorhanden als in Zellen, in die PSD- 95-WT zusammen mit den non-silencing-Konstrukten pSuper eGFP und pSuper Renilla eingebracht wurde. Dies lässt darauf schließen, dass das pSuper PSD-95-Knockdown-Konstrukt tatsächlich eine expressionsmindernde Wirkung hat, die offensichtlich speziell auf die Sequenz zurückzuführen ist, welche für die shRNA kodiert, denn nur in dieser unterscheidet sich pSuper PSD-95 KD von den beiden anderen pSuper-Konstrukten.

Mehr noch: Die Tatsache, dass im Gegensatz zu PSD-95-WT weder beim strukturell ähnlichen DLG3, noch bei der in nur sechs Nukleobasen modifizierten Variante PSD-95 KDres die in der Zelle gebildete Menge an Protein durch pSuper PSD-95 KD reduziert wird, zeigt, dass die expressionsmindernde Wirkung von pSuper PSD-95 eigens auf WT-PSD-95 beschränkt ist, womit sich ein bloßer Off-Target- Effekt des pSuper PSD-95 KD-Konstrukts, der unspezifisch die Expression anderer Proteine herabsetzt, vollends ausschließen lässt.

Diese explizite Selektivität auf Nukleinsäureebene lässt nur den Schluss zu, dass dem Funktionieren des pSuper PSD-95 KD-Konstrukts tatsächlich der gewünschte RNAi-Mechanismus zugrunde liegt.

Ferner kann bestätigt werden, dass die Expression der KD-resistenten Variante von PSD-95, die sich von Wildtyp-PSD-95 nur durch den Austausch von sechs Wobble-Basen in der Nukleinsäuresequenz unterscheidet, durch pSuper PSD-95 KD nicht beeinträchtigt wird, die geplante Knockdown-Resistenz sich also auch in realitas zeigt.

3.3 Quantifizierung der Knockdown-Effizienz

Nach dem bisherigen, eher qualitativen Nachweis für das Funktionieren des Knockdown mittels pSuper- Konstrukt sowie der RNAi-Resistenz der PSD-95 KDres-Variante soll nun eine quantitative Analyse folgen.

3.4.1 Titration von pSuper PSD-95 KD im Western Blot

Bei dieser semiquantitativen Versuchsreihe wurden COS-7-Zellen mit 0.2 µg Wildtyp-PSD-95 im pCherry-N1-Vektor und einer steigenden Konzentration (0.05, 0.1, 0.2 sowie 0.4 µg p. W.) von pSuper PSD-95 kotransfiziert. Die Zelllysate wurden anschließend über eine SDS-PAGE aufgetrennt, auf PVDF-Membran geblottet und mit αpCherry und αTubulin als Ladungskontrolle inkubiert. Über unter- schiedlich starke PSD-95-Banden in den Spuren mit verschiedenen pSuper-Konzentrationen sollen so Rückschlüsse über die Knockdown-Effizienz gezogen werden können. Der entwickelte Western Blot ist Abbildung 19 zu entnehmen.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 19. Kotransfektion von pCherry-N1 PSD-95 WT (0.2 µg) zusammen mit einer v.l.n.r. steigenden Konzentration an pSuper PSD-95 KD-Konstrukt. Rechts daneben die entsprechende Kotransfektion mit pSuper Renilla als Negativ-Kontrolle. Der WB wurde inkubiert mit αPSD-95 (Stressgen), Ladungskontrolle mittels αTubulin. Die Mengenangaben beziehen sich auf ein Well.

Bei Betrachtung des WB als Ergebnis des Titrationsversuchs fällt sofort auf, dass die PSD-95-Banden bei Kotransfektion mit pSuper PSD-95 wesentlich schwächer ausfallen als bei Kotransfektion mit der Negativ-Kontrolle pSuper Renilla. Auch in diesem Versuch bestätigt sich also die expressionsmindernde Wirkung von pSuper PSD-95 auf Wildtyp-PSD-95, welche im vorangegangenen Abschnitt gezeigt und auf den funktionierenden RNAi-Mechanismus der kodierten shRNA zurückgeführt werden konnte. In der Titration sehen wir zudem, dass diese expressionsmindernde Wirkung auch noch bei der kleinsten transfizierten pSuper PSD-95-Konzentration von 0.05 µg p. W. sehr deutlich ausgeprägt ist. Die Unter- drückung der Expression von Wildtyp-PSD-95 auf mRNA-Ebene mithilfe von RNA-Interferenz kann also mit Recht als sehr effizient bezeichnet werden. Erstaunlicherweise zeigt sich eine Art Sättigungs- verhalten: Es ist in Anbetracht der steigenden Menge an transfiziertem pSuper PSD-95 KD kaum ein Unterschied hinsichtlich der PSD-95-Bandenqualität in Abbildung 19 erkennbar. Schon bei einer niedrigen Menge an transfiziertem pSuper-Konstrukts stellt sich offenbar ein ähnlich hoher KD-Erfolg ein wie bei den höchsten eingesetzten Konzentrationen. Auch dies lässt auf eine hohe Effizienz des RNAi- Mechanismus schließen.

Auffällig ist bei der Betrachtung der Tubulin-Banden – und zwar sowohl bei Probe, als auch Kontrolle –, dass die Bandenstärke mit wachsender pSuper-Konzentration zuzunehmen scheint (→Diskussion Abschn. 4.2 ).

3.4.2 Durchflusszytometrische Quantifizierung

Die Wirkung des pSuper PSD-95 KD-Konstrukts soll zur vergleichenden Analyse auch mithilfe von Durchflusszytometrie untersucht werden.

Hierzu wird die Fluoreszenz von nativen COS-7-Zellen erfasst und mit jener von COS-7-Zellen verglichen, welche mit eYFP-N1 PSD-95 (WT) in Kombination mit pSuper PSD-95-KD, pSuper Renilla (als Negativ-Kontrolle) oder pSuper eGFP (als Positiv-Kontrolle) kotransfiziert wurden. Je nachdem, ob und wie stark die Expression des fluoreszenten Fusionsproteins aus PSD-95 und eYFP durch von dem jeweiligen pSuper-Konstrukt ausgelöste RNA-Interferenz unterdrückt wird, sollte die gemessene Fluoreszenz der Zellen dabei unterschiedlich ausfallen. Das Ergebnis der vier Fluoreszenz-Messungen illustriert Abbildung 20.

Hier zeigt sich, dass auch die nativen COS-7-Zellen eine gewisse Fluoreszenz aufweisen, wobei die Intensität augenscheinlich normalverteilt zu sein scheint (→ Abschn. 4.3 ). Diese „natürliche“ Fluores- zenz der COS-7-Zellen gilt es für eine Analyse der „artifiziellen“ Fluoreszenz aufgrund von exprimiertem Fluoreszenz-Protein zu berücksichtigen. Dazu beschränken wir unsere Betrachtungen auf den Anteil der Zellen einer Kultur, deren Fluoreszenz eine gewisse Schwelle überhalb der typischen natürlichen Intensität übersteigt. Konkret wurde die Schwelle so gewählt, dass die Fluoreszenz von 99.7 % der nativen Zellen unterhalb von ihr liegt; in Abbildung 20 ist sie durch den mit M bezeichneten Balken repräsentiert.

Betrachten wir im Gegensatz zu den nativen COS-7-Zellen diejenigen, welche mit pEYFP-N1 PSD-95 (WT) und dem non-silencing-Konstrukt pSuper Renilla transfiziert wurden, so stellen wir fest, dass ein beträchtlicher Anteil der Zellen (knapp 70 %53 ) eine Fluoreszenz überhalb der Schwellintensität aufweist. Auch sehr hohe Intensitäten von mehr als dem Tausendfachen an natürlicher Fluoreszenz werden dabei von einzelnen transfizierten Zellen erreicht.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 20. Halblogarithmische Histogramme aus der durchflusszytometrischen Untersuchung verschieden behandelter Zellen. Aufgetragen ist die Zahl der gezählten Zellen gegenüber der jeweiligen Fluoreszenzintensität. In jedem der vier Fälle wurde die Fluoreszenz von je 104 Zellen gemessen. Von oben links im Uhrzeigersinn:

Native COS-7-Zellen, Zellen kotransfiziert mit pEYFP-N1 PSD-95 (WT) + pSuper Renilla (non-silencing- Kontrolle), pEYFP-N1 PSD-95 (WT) + pSuper eGFP (silencing-Kontrolle) und pEYFP-N1 PSD-95 + pSuper PSD-95 KD.

Wird dagegen die Expression des fluoreszenten Fusionsproteins eYFP-PSD-95 (WT) aus dem pEYFP- N1-Vektor via RNA-Interferenz unterdrückt, wie bei Kotransfektion mit pSuper PSD-95 KD oder pSuper eGFP (silencing-Kontrolle), so geht speziell die Zahl der Zellen mit sehr hoher Fluoreszenz stark zurück, überdies sinkt der Anteil der Zellen mit überschwelliger Intensität insgesamt auf 30 bis 40 %. Auch in der durchflusszytometrischen Untersuchung lässt sich also der expressionsmindernde Effekt der Konstrukte pSuper PSD-95 KD und pSuper eGFP auf ein entsprechendes Zielprotein nachweisen. Im Gegensatz zur Analyse im Western Blot erfahren wir jedoch darüberhinaus, dass die Expression des Zielproteins sich mithilfe von RNA-Interferenz nicht komplett unterdrücken lässt, wie im WB durch mitunter totales Verschwinden der relevanten Bande suggeriert, sondern lediglich reduziert werden kann.

Um die verschiedene Knockdown-Wirkung von pSuper PSD-95 KD auf eYFP-getagtes Wildtyp-PSD-95 und das modifizierte PSD-95 KDres besser einordnen zu können, wurde eine vergleichende Versuchsreihe mit silencing- und non-silencing-Kontrollen angesetzt. Hierzu wurden Wildtyp-PSD-95 und seine KD- resistente Variante PSD-95 KDres, beide im pEYFP-N1-Vektor, in verschiedenen Ansätzen mit pSuper PSD-95 KD, pSuper-eGFP (als silencing-Kontrolle) oder pSuper Renilla (als non-silencing- Kontrolle) kombiniert.

Um die statistische Belastbarkeit der Ergebnisse zu erhöhen, wurde dabei jede dieser Kombinationen unabhängig voneinander in drei verschiedenen Wells transfiziert. Nach Ernte der Zellen wurde dann im Durchflusszytometer der Anteil von Zellen überschwelliger Fluoreszenz (vgl. Balken M in Abbildung 20) für die einzelnen Wells separat bestimmt und anschließend die Mittelwerte sowie Standardabweichungen der Triplikate ermittelt. Diese Daten sind in Tabelle 4 zusammengefasst.

Tabelle 4. Die durchflusszytometrische Auswertung des Knockdown der PSD-95-Varianten Wildtyp und KDres im pEYFP-N1-Vektor mittels verschiedener pSuper-Konstrukte. Kotransfiziert wurde in Triplikaten, aus den einzeln bestimmten Fluoreszenzen dann das arithmetische Mittel gebildet. Angegeben sind relative Werte, bezogen auf die Fluoreszenz der Negativ-Kontrolle „WT + pSuper Renilla“, die hierzu ad 100 % gesetzt wurde.

Abbildung in dieser Leseprobe nicht enthalten

Die Ergebnisse sind in folgender Abbildung 21 durch ein Balkendiagramm veranschaulicht. Die Fehlerbalken geben die errechneten Standardabweichungen an.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 21. Durchflusszytometrische Auswertung der Fluoreszenzen von mit WT- und KDres-Varianten von PSD-95-eYFP im N1-Vektor in Kombination mit verschiedenen pSuper-Konstrukten kotransfizierten COS-7-Zellen (s. Tabelle 4). Die Fehlerbalken spiegeln die jeweiligen Konfidenzintervalle der Messungen wider.

Wir sehen, dass die Fluoreszenz der Zellen, welche mit Fluorophor-getagtem PSD-95 in Kombination mit pSuper eGFP transfiziert wurden (silencing-Kontrolle) ca. 30 % geringer ausfällt als in der non-silencing- Kontrolle mit pSuper Renilla. In Übereinstimmung mit den Beobachtungen aus Abbildung 20 lässt sich also mithilfe des Durchflusszytometers die Unterdrückung der Expression des Fluorophor-getagten Proteins via RNA-Interferenz nachweisen, wenn auch selbst bei positivem Knockdown eine deutliche Restfluoreszenz messbar bleibt.

Die Effizienz des Knockdown von Wildtyp-PSD-95 mit dem pSuper PSD-95 KD-Konstrukt schneidet mit einer Fluoreszenz ca. 20 % unterhalb der non-silencing-Kontrolle nur wenig schlechter ab als pSuper eGFP. Die Resistenz des pEYFP-N1 PSD-95 KDres-Konstrukts gegenüber einem Knockdown durch pSuper PSD-95 KD hingegen wird eindrucksvoll bestätigt: Die vom fluoreszenten Fusionsprotein verursachte Fluoreszenz stimmt im Rahmen seines Konfidenzintervalls mit derjenigen der non-silencing- Kontrollen überein.

3.4 Expressionsnachweis von pLentiLox PSD-95 KDres- pCherry mittels Western Blot

Um zu überprüfen, ob auch das durch die in Abschn. 3.1 geschilderten Klonierungsschritte gewonnene PSD-95 KDres-Konstrukt im pLentiLox-Vektor tatsächlich auch in vitro funktionstüchtig ist und nachweisbare Expression zeigt, wurde das Plasmid in COS-7-Zellen transfiziert und der Gehalt an exprimiertem PSD-95 im Vergleich zu anderen PSD-95-Vektoren via WB ausgewertet. Der entwickelte Film ist in Abbildung 22 dargestellt.

Abbildung in dieser Leseprobe nicht enthalten

Abbildung 22. Funktionstest des pLL3.7 PSD-95 KDres-pCherry-Konstrukts. Ganz links Zelllysat von mit dem pLentiLox-Konstrukt transfizierten COS-7-Zellen, rechts daneben die Positiv-Kontrollen mit pCherry-N1 PSD-95 und FLAG-getagtem PSD-95 im pCMV-Tag-Vektor. Ganz rechts die Negativ-Kontrolle (COS-7 nativ). Inkubiert wurde mit αPSD-95 (Stressgen).

Obwohl gleiche Mengen DNA transfiziert und in allen Spuren gleichviel Lysat geladen wurde, ist, wie man in obigem WB sieht, die pCherry-PSD 95-Bande im Falle des LentiLox-Vektor wesentlich schwächer ausgeprägt als bei den Positiv-Kontrollen mit pCherry-N1- und pCMV-Tag-Vektor.

Die Laufhöhen betreffend sehen wir, dass die LentiLox-Hauptbande auf gleicher Höhe mit der unteren der beiden pCherry-PSD-95-Hauptbanden des pCherry-N1-Konstrukts gelaufen ist. Aufgrund des niedrigeren Molekulargewichts54 ist die pCMV-Tag-Bande ein kleines Stück unterhalb von ihnen zu sehen.

In der Nl-Spur ist zudem noch eme weitere, obere Hauptbande auszumachen, welche auch schon in fniheren W estern Blots sichtbar war (z. B. Abbildung 19); auch die erzielten Laufhohen insgesamt sind konsistent mit friiheren Ergebnissen.

§ 4 Diskussion

4.1 Laufverhalten von PSD-95 in der SDS-PAGE

In den verschiedenen hergestellten Western Blots (z. B. Abbildung 10) konnte immer wieder beobachtet werden, dass das exprimierte PSD-95 nicht nur in einer einzigen, sondern in mehreren (Haupt-)Banden lief. Dabei handelt es sich wahrscheinlich um verschiedene posttranslationale Modifikationsstufen des PSD-95, die nebeneinander vorkommen und unterschiedliches Wanderungsverhalten in der SDS-PAGE zeigen.

Durch die Modifikationen können während des Zellstoffwechsels die Funktion, Wechselwirkungen mit anderen Proteinen und allgemein die Eigenschaften des Gerüstproteins moduliert werden. Beispielsweise werden am N-Terminus von PSD-95 die Cystein-Reste Cys3 und Cys5 über eine Thioester-Bindung kovalent mit Palmitinsäure verknüpft [E. KIM, 2004], was die Membranständigkeit und Interaktion mit Ionenkanälen reguliert [TOPINKA, 1998]. Phosphorylierungen, in Form von Esterbindungen der Orthophosphorsäure an Hydroxy-Gruppen tragende Aminosäuren, wie etwa an Serin 295 bei PSD-95, stehen im Verdacht, mitverantwortlich für synaptische Plastizität zu sein [M. J. KIM, 2007]. Durch diese posttranslationalen Modifikationen werden Masse und Ladung des Proteins verändert und damit potentiell auch sein Wanderungsverhalten in der SDS-PAGE. Auswirkungen auf Faltungsverhalten, etc., die von solchen Modifikationen in vivo eventuell auftreten könnten, bewirken indes kein neues Wanderungsverhalten in der SDS-PAGE, da durch das Aufkochen und die stark denaturierende Wirkung des SDS alle Sekundär- und Tertiärstrukturen zerstört sind und die Proteine eine im allgemeinen ellipsoide Form annehmen [STRYER, Biochemie], wodurch eine Auftrennung allein nach der Proteinmasse möglich werden soll.55 Angesichts der Protein-Gesamtmasse im Bereich von vielen Kilodalton sollte die Massenänderung durch Phosphorylierung (ca. 98 Da) oder Palmitoylierung (ca. 256 Da) jedoch eine untergeordnete Rolle spielen. Einen größeren Effekt könnte die Ladungsänderung durch die Phosphorylierung haben, denn bei TRIS-Pufferung56 ist die Phospho-Gruppe dreifach anionisch geladen. Auch dieser Effekt wird allerdings teilweise relativiert, wenn man sich vergegenwärtigt, dass durch die Bindung von SDS ans Protein (d. h. ca. eine zusätzliche negative Ladung pro zwei Aminosäuren) das denaturierte Protein bereits eine sehr hohe Eigenladung besitzt, weswegen die relative Ladungsänderung bei einer Phosphorylierung im Bereich im niedrigen einstelligen Prozentbereich liegt. Dieser Unterschied kann aber offenbar ausschlaggebend sein.

Eine weitere Erklärung für die Doppelbanden könnten Nebenprodukte der Genexpression sein, die durch einen vorzeitigen Translationsabbruch gebildet werden. Die Bildung solcher Fragmente ist gerade bei überlangen Fusionsproteinen oder der KDres-Variante, die an den Stellen der Wobble-Austausche womöglich einen weniger üblichen Codon-Gebrauch aufweist, nicht unwahrscheinlich. U. a. an solchen Stellen kann die Translationsmaschinerie ins Stocken geraten, wodurch die Translation bevorzugt hier verfrüht abbricht [WATSON, Molekularbiologie]. Es kommt zu einer Häufung von Fragmenten dieser Länge, sodass sie eine eigene Bande im Western Blot ausbilden können.

Dieser zweite Erklärungsansatz allein kann jedoch wiederum allein für die Doppelbanden verantwortlich nicht sein, denn gerade auch die transfizierten Fusionsproteine aus PSD-95 mit eYFP oder pCherry zeigten im WB Doppelbanden. In den klonierten Konstrukten war dabei jeweils das Chromophor stromabwärts vom PSD-95 gelegen. Fluoreszente Proteine zeigen i. d. R. nur dann nachweisbare Fluoreszenz, wenn sie korrekt und komplett translatiert sind.57 Jedoch konnte zumindest durchflusszytometrisch eine deutliche Fluoreszenz des Fusionsproteins nachgewiesen werden (vgl. Abbildung 20). Auch waren im WB bei Verwendung von pigmentspezifischen Antikörpern (z. B. αpCherry) deutliche Mehrfachbanden sichtbar – was beides zumindest ausschließt, dass die Translation des Fusionsproteins bereits vor dem Chromophor abgebrochen sein kann.58 Aufgrund dieser Befunde ist wahrscheinlich, dass zumindest ein nicht unerheblicher Prozentsatz an Fusionsprotein fertig zu Ende exprimiert wird.

Die Erklärung für die sichtbaren Doppelbanden ist daher mit Sicherheit eine Kombination aus beiden Effekten, sowohl posttranslationalen Modifikationen als auch vorzeitigen Translationsabbrüchen.

4.2 Varianz bei Tubulin-Banden

Beim Titrationsversuch zur Überprüfung der Knockdown-Effizienz in Abhängigkeit des DNA-Mengenver- hältnisses zwischen PSD-95 und pSuper PSD-95 KD bei Transfektion in COS-7-Zellen (Abschn. 3.4.1 ) war die hohe KD-Effektivität des pSuper-Konstrukts schon bei niedrigen Konzentrationen gezeigt worden, sowie, dass eine Erhöhung keine Effizienzsteigerung zur Folge hatte (Sättigungsverhalten). Eine weitere Beobachtung war eine Zunahme der Tubulin-Banden (Ladungskontrolle) mit steigender pSuper- Konzentration (vgl. Abbildung 19). Eine mögliche Erklärung hierfür könnte ein erhöhter Transfek- tionsstress für die Zellen bei zu niedriger DNA-Konzentration sein:

In der Versuchsreihe wurde in allen Wells die zugegebene Menge an Lipofectamine (1 µl p. W.) und N1 PSD-95-pCherry (0,2 µg p. W.) konstant gehalten und jeweils nur die Menge an pSuper-PSD-95 KD (0,05, 0,1, 0,2 und 0,4 µg p. W.) variiert. Dadurch verschob sich auch das Verhältnis von DNA zu Lipofectamine in der Transfektionslösung. Es wäre möglich, dass die COS-7-Zellen bei einer Transfektion ein höheres Verhältnis DNA/Lipofectamine besser verkraften, sodass sie sich entweder noch weiter teilen und somit Zellmasse und damit Tubulin aufbauen, oder dass sie zumindest weniger oft aufgrund der Toxizität des kationischen Lipofectamine nekrotisch absterben. Hierbei wird auch das Zytoskelett um- und abgebaut [PHELPS, 1996; TRUMP, 1997], was der Grund für die abnehmenden Banden in der Ladungskontrolle (αTubulin) bei niedrigem DNA/Lipofectamine-Verhältnis sein könnte.

4.3 Western Blot vs. Durchflusszytometrie

Vergleicht man die Auswertungen des Expressionserfolgs mittels Western Blot und Durchflusszytometrie, so erkennt man schnell die Vor- und Nachteile beider Methoden. Während der WB nur auf die Verfügbarkeit eines spezifischen Antikörpers angewiesen ist, ist die Durchflusszytometrie prinzipiell beschränkt auf Proteine, die einen Fluoreszenzmarker tragen. Für die Genauigkeit und Aussagekraft ist beim WB die Güte des Antikörpers ausschlaggebend, bei der Durchflusszytometrie hingegen ist die Vorauswahl-Einstellung für die Zellen und die Definition, ab wann Fluoreszenz als artifiziell gilt, kritisch. Sonst kann die diffuse Hintergrundfluoreszenz (vgl. Abschn. 4.4 ) Fehlinterpretationen provozieren.

Außerdem erwies sich die Methode der Durchflusszytometrie als nachweisempfindlicher. So konnte die Expression mancher Proteine bei Knockdown-Versuchen im Western Blot bisweilen kaum bis gar nicht mehr nachgewiesen werden (vgl. z.B. Abbildung 19), während das Vorhandensein des fraglichen Proteins im Durchflusszytometer zweifelsfrei nachweislich blieb (Abbildung 20). Da PSD-95 im pEYFP-N1-Vektor eingesetzt wurde, in welchem das Fluorophor in Leserichtung hinten am PSD-95 hängt, kann zudem ausgeschlossen werden, dass bspw. die Translation nach dem Chromophor abgebrochen wurde und deswegen zwar Fluoreszenz, nicht jedoch das PSD-95 nachweisbar wäre, was die schwache Sichtbarkeit im WB erklären würde.

Unbestreitbarer Vorteil der Durchflusszytometrie ist zudem die Möglichkeit, die Expressionsstärke relativ exakt quantitativ zu erfassen.

4.4 Theoretische Betrachtung der Durchflusszytometrie

Im Durchflusszytometer ist auch bei nativen COS-7-Zellen eine gewisse Fluoreszenz messbar (Abbildung 20). Die Fluoreszenz ist wohl auf Zellbestandteile zurückzuführen, die (zufällig) leicht fluoreszierende Eigenschaften für die eingesetzte Laserwellenlänge besitzen und die, je nach physischer Verfassung und aktueller Position im Zellzyklus, unterschiedlich stark exprimiert sind. Deswegen ist auch, obwohl es sich bei den Zellen um genetisch identische Klone handelt, in ihrer Fluoreszenz eine gewisse Varianz um einen Median feststellbar. Die Verteilung der Fluoreszenzintensitäten entspricht in etwa einer Normal- verteilung in halblogarithmischer Auftragung.

Dieser Peak taucht auch bei allen anderen Zellen, die mit pEYFP-N1 PSD-95 in Kombination mit pSuper-Konstrukten kotransfiziert wurden, als Hintergrundintensität wieder auf.

Es erscheint zuerst verwunderlich, dass bei den Quantifizierungsversuchen zur RNAi-Effizienz (Abschn. 3.4.2 ) die als artifiziell definierte Fluoreszenz beim Knockdown durch pSuper PSD-95 KD oder pSuper eGFP nur 20 bzw. 30 % unterhalb der Negativ-Kontrollen liegt, obwohl der RNAi-Mechanismus normalerweise als sehr effektive Methode zur Gen-Stilllegung beschrieben wird. Hierzu muss man sich jedoch vergegenwärtigen, dass bei diesen Doppeltransfektionen das Gen für die Expression des fluoreszenten Fusionsproteins von einem CMV-Promotor befördert wird. Dieser provoziert eine über- natürlich starke Transkription des Zielproteins [FOECKING, 1986], was eine große Herausforderung für den durch U6-promovierte shRNA aktivierten RNAi-Mechanismus darstellt. Es ist deswegen davon auszugehen, dass bspw. der Knockdown eines zellintern natürlich exprimierten Gens, das nur in viel geringerer Geschwindigkeit und Kopienzahl transkribiert wird als das PSD-95-eYFP unter CMV- Promotor, wesentlich effektiver ausfällt, da das Verhältnis Holo-RISC zu Ziel-RNA im Vergleich zugunsten des RISC-Komplexes verschoben ist. Es ist also nicht unwahrscheinlich, dass die klonierten Konstrukte beim tatsächlich anvisierten Einsatz des Konstrukts zum KD des endogenen PSD-95 in Neuronen trotzdem eine wirkungsvolle Gen-Stilllegung bewirken.

4.5 Expression des lentiviralen Konstrukts

In Abschn. 3.4 wurde der Nachweis für die Expression von PSD-95 KDres-pCherry aus dem LentiLox- Plasmid in COS-7-Zellen im Western Blot nachgewiesen.

Dass das Fusionsprotein aus dem LentiLox-Vektor überhaupt exprimiert wird, war nicht von vornherein klar, schließlich handelt es sich bei dem LentiLox-Plasmid um ein mit ca. 7.65 kBp [MIT CFCR, 3.10.2012] fast doppelt so großes Plasmid wie etwa pCMV-Tag oder den pEYFP- bzw. pCherry-N1- Vektor. Das kann zu Komplikationen führen. Z. B. könnte die Größe des Plasmids bei der Transfektion hinderlich sein, oder beim intrazellulären Transfer des Plasmids in den Zellkern, wo schließlich erst Transkription und Translation erfolgen.

Im WB (Abbildung 22) zeigte sich dann auch, dass die mit dem LentiLox-Konstrukt transfizierten COS- 7-Zellen eine wesentlich schwächere Expression des Fusionsproteins aus PSD-95 KDres und pCherry aufwiesen als die, welche mit pCherry-N1-Vektor transfiziert worden waren. Und das trotz gleichem Transfektionsprotokoll und gleichem Promotor (CMV). Das mag zum einen an den o. g. Gründen liegen, zum anderen auch daran, dass es sich einfach um zwei verschiedene Vektoren mit möglicherweise ganz eigenen Nebeneffekten handelt. So befindet sich im LentiLox-Plasmid z. B. direkt vor dem CMV- Promotor die Knockdown-Kassette, die die Expression stromabwärts evtl. beeinflussen könnte. Es gilt zudem noch folgenden Faktor zu berücksichtigen: In allen Fällen wurde nämlich jedem Well dieselbe Masse an DNA zugegeben. Da das LentiLox-Plasmid jedoch ungefähr doppelt so lang und dementsprechend auch etwa doppelt so schwer ist wie pCMV-Tag und N1-Vektor, heißt das, dass hier die Molarität in der Transfektionslösung nur halb so groß war wie im Falle der beiden kleineren Vektoren. Entsprechend weniger große Plasmide sollten von den Zellen aufgenommen worden sein, was sich dann zusätzlich auf die Menge an exprimiertem Protein niederschlägt.

Man könnte versuchen, diese Inäquivalenz zu kompensieren, indem man die eingesetzte Masse an LentiLox-Konstrukt p. W. verdoppelt und so gleiche Zahlen an Plasmiden zu transfizieren. Da das Transfektionsprotokoll jedoch für ein abgestimmtes Massenverhältnis zwischen DNA und Lipofectamine optimiert ist, würde dadurch wahrscheinlich die Transfektionseffizienz beeinflusst. Eine direkte Vergleichbarkeit wäre also wiederum nicht gegeben.

Abgesehen von dieser Problematik ist zumindest der qualitative Nachweis, dass das KD-resistente PSD- 95-pCherry-Konstrukt auch in Neuronen exprimiert wird, schon erbracht: In der AG Rosenmund des NWFZ wurden murine Neuronen bereits – allerdings unter Verwendung eines anderen lentiviralen Vektorsystems, das einen neuronenspezifischen Promotor statt dem aus CMV nutzt – mit dem wie in Abschn. 3.1.3 beschrieben klonierten PSD-95-pCherry-Konstrukt infiziert und zeigten als Folge unter dem Fluoreszenz-Mikroskop rote Fluoreszenz.

4.6 Zukunft des LentiLox-Konstrukts

Das klonierte pLentiLox PSD-95 KDres-pCherry-Konstrukt weist noch eine entscheidende Schwachstelle auf. Im Moment besitzt es nämlich nur die Fähigkeit zur Expression von PSD-95 KDres-pCherry bei Transfektion (oder Infektion) einer Zelle. Will man – wie es bspw. für Untersuchungen an Neuronen wünschenswert sein kann – endogenes PSD-95 per Knockdown reduzieren und anstattdessen das KD- resistente PSD-95-pCherry exprimieren, so ist es momentan noch notwendig, eine Doppeltransfektion/- infektion mit dem KDres- und einem separaten shRNA-Konstrukt zusammen durchzuführen. Das ist jedoch in der Handhabung etwas unpraktisch, u. a. weil hierfür zuerst virushaltige Lysate mit ungefähr gleich hohem Titer bereitgestellt werden müssen. Zudem ist es von Nachteil, dass die beiden Konstrukte bei einem solchen Doppeltransfer immer nur statistisch in die Zellen gelangen. Das heißt, auch bei Verwendung exakt gleicher Titer werden sich die einzelnen infizierten Zellen in ihrem Verhältnis KDres- zu shRNA-Konstrukt unterscheiden. Diese ungleichen Bedingungen führen bei nachfolgenden Experimenten mit den infizierten Zellen unweigerlich zu einer größeren Streuung der gewinnbaren Daten und damit zu weniger klar interpretierbaren Ergebnissen.

Die Lösung dieses Problems bestünde in der Insertion des für die shRNA kodierenden Sequenzabschnitts in ein gemeinsames LentiLox-Plasmid mit dem KDres-shRNA-Konstrukt. Mit der vorgesehenen Klonierungsstelle hinter dem Maus U6-Promotor (s. Abbildung 8) eignet sich der LentiLox-Vektor hierfür hervorragend. Vorbereitungen für diesen Klonierungsschnitt wurden mit der Entfernung der zweiten XhoI-Schnittstelle (Abschn. 3.1.3 ) schon getroffen. Auch die DNA-Oligonukleotide (sense- und antisense-Strang), die für die in den pSuper PSD-95 KD-Konstrukten gut funktionierende shRNA zum KD von Wildtyp-PSD-95 wurde, dem empfohlenen Protokoll59 folgend, bereits für den Einsatz im LentiLox-Plasmid modifiziert und synthetisiert (s. Abschn. Error! Reference source not found.). Erste Versuche, die hybridisierten Oligonukleotide und mithilfe von HpaI und XhoI in den Vektor zu klonieren, scheiterten daran, dass das doppelsträngige Oligonukleotid, wie sich zeigte, nur schwerlich in das geschnittene Rückgrat inseriert wird. Auch eine Steigerung der Konzentration der Oligonukleotide gegenüber dem Rückgrat im Ligationsansatz brachte keinen Erfolg. Obwohl die beiden eingesetzten Restriktionsenzyme eigentlich inkompatible Enden schneiden, kam es zur Religation des Plasmids ohne Einbau des Oligonukleotids. Das könnte z. T. auch daran liegen, dass HpaI glatte Enden schneidet, was evtl. die Selbstligation der eigentlich ungleichen Doppelstrangenden des verdauten Plasmids erleichtert. Eine Möglichkeit, diese Problematik zukünftig zu umgehen, könnte sein, das geschnittene Plasmid vor der Ligation mit CIP zu behandeln, um so prinzipiell zu verhindern, dass sich die beiden Enden des linearisierten Plasmids religieren und dadurch die Insertion des (unbehandelten) Oligonukleotids zur obligatorischen Voraussetzung für die Rezyklisierung des Plasmids zu machen. Damit könnte man sicherstellen, dass später jedes intakte, rezyklisierte Plasmid das Insert trägt. Die Ligationsprodukte würden dann wie gewöhnlich in E. coli Stbl2 transformiert. Da nur die zyklischen Plasmide von den Bakterien korrekt/komplett repliziert und damit auf die Tochtergenerationen weitergegeben werden können, wäre die Ausbildung der Amp-Resistenz als Selektionsmerkmal einer Bakterien-Einzelkolonie gleichzeitige Gewährleistung für das Tragen des intakten Plasmids.

Steht ein solches LentiLox-Konstrukt erst bereit, das sowohl über eine Knockdown-Kassette zur Unterdrückung der Expression von endogenem PSD-95 in Neuronen via shRNA-induzierter RNA- Interferenz, als auch über die Fähigkeit zur Überexpression von Knockdown-resistentem PSD-95 mit pCherry-Tag, können einfach und schnell verschiedene weitreichende Untersuchungen vorgenommen werden:

Bei einer Infektion von Neuronen mit diesem kombinierten Konstrukt würde eine weitgehende Stilllegung des Gens für PSD-95 ausgelöst. Stattdessen würde in den Neuronen die wegen ihres Fluorophor-Tags in der Zelle mikroskopisch direkt zu beobachtende Knockdown-resistente PSD-95-Variante überexprimiert. Das machte es zum einen möglich, die Lokalisation des PSD-95 innerhalb der Zelle zu ermitteln und über verschiedene Zellstadien hinweg mitzuverfolgen.

Zum anderen könnten effektiv die Auswirkungen von verschiedenen Mutationen des PSD-95 gezielt untersucht werden. Dafür kommen etwa Mutationen infrage, die von klinischer Seite her im Verdacht stehen, mit etwaigen phänotypischen Krankheiten zusammenzuhängen. Wenn solche Mutationen bekannt würden, ist es nämlich mit einem relativ geringen Arbeitsaufwand möglich, diese in das Fluorophor-getagte, KD-resistente PSD-95 im LentiLox-Vektor einzubauen. Mit diesem Vektor würden Neurone infiziert, in denen daraufhin die Expression des „gesunden“, endogenen PSD-95 unterdrückt und stattdessen die mutierte Variante exprimiert würde. Da diese durch das pCherry-Tag fluoreszenzmarkiert ist, könnte direkt untersucht werden, ob die mutante Variante an dieselben Stellen in der Zelle transportiert wird wie das Wildtyp-PSD-95, ob sie sich dort in denselben Konzentrationen ansammelt, etc. Mit weiteren Methoden wie etwa Elektrophysiologie könnte darauf aufbauend untersucht werden, ob die Mutation Auswirkungen auf die elektrische Reizaufnahme und -weiterleitung hat. Das Auftreten solcher Anomalitäten in der Reizverarbeitung wiederum kann ein direkter Hinweis auf die pathologische Wirkung der untersuchten Mutation sein. Da es mit den LentiLox-Viren darüberhinaus möglich wäre, durch Injektion des Lysats ins Gehirn eines Modellorganismus wie der Maus direkt lebende Zellen in vivo zu infizieren und dort das „gesunde“ durch mutantes PSD-95 zu ersetzen, ist zumindest möglich, dass die Auswirkung der Mutation auch unmittelbar anhand von Verhaltensstudien aufzudecken sein könnten. Mithilfe dieser Vorgehensweise ist es möglich, systematisch Mutationen von PSD-95, welche als Kandidaten für die Ursache einer neuronalen Störung oder Krankheit infrage kommen, mit – vor allem im Vergleich zur diffizilen und langwierigen Prozedur der Erzeugung transgener und Knockout-Varianten von Zelllinien oder Organismen – bescheidenem Arbeitseinsatz und hoher Geschwindigkeit durchzu- rastern.

Dies wäre ein beschleunigender und sicherlich bedeutender Schritt in der Aufklärung der Rolle dieses zentralen Gerüstproteins in der Funktion des Gehirns allgemein und hinsichtlich der Krankheiten, die von einer möglichen Mutation ausgehen, im speziellen.

Appendix

i. Spezifizierung der eingesetzten Zellen

Die verwendete Zelllinie der COS-7-Zellen wurde ursprünglich über Fr. Susanne Freier vom Berliner Max-Planck-Institut für Molekulare Genetik bezogen. Primäre Neuronenkulturen werden durch Präparation der Hippocampi von E18-Labormäusen (Mus musculus) aus dem Tierstall der Charité – Universitätsmedizin Berlin gewonnen.

ii. Zusammensetzung und/oder Herkunft verwendeter Medien und Lösungen

- Blotting-Puffer (MPI, 5x): 240 mM TRIS, 196 mM Glycin, 0.185 % SDS
- COS-7-Zellen, Nährmedium für: 20 ml 10%iges FCS, 2 ml P/S, 2 ml 200 mM L- Glutamin (# BE 17-605E von Lonza, CH), DMEM ad 200 ml
- DMEM: standardisiertes Nährmedium (# 12-707F von Lonza, CH)
- LAEMMLI-Puffer (10x): 150 g TRIS, 720 g Glycin, 50 g SDS, ad 5000 ml H O
- LB-Medium/Agar: 10 g Trypton, 10 g NaCl, 5 g Hefeextrakt, (15 g Agar-Agar,) ad
-000 ml H2O
- Opti-MEM serumreduziertes Medium: chemisch definiertes Spezialmedium für
-ransfektionen (Invitrogen, CA, USA)
- DPBS (# 17-512F von Lonza, Basel, Schweiz)
- Neuronen-Nährmedium: 10 ml 50x B27 Supplement (Gibco, CA, USA), 1.25 ml 50 mM L-Glutamin (# BE 17-605E von Lonza, CH), 500 ml Neurobasalmedium A (# 21103-049 von Gibco, CA, USA)
- PBST: (D)PBS mit 0.1 % Tween 20 (= Polysorbat 20)
- SDS-PAGE-Puffer (5x): 1.5 ml β-Mercaptoethanol (15 %), 1.5 g SDS (15 %), 0.15 g
Bromphenolblau (1.5 %), 5.75 ml Glycerin (50 %), ad 10 ml Puffer 2
- TAE (50x): 242 g TRIS, 100 ml 0.5 M EDTA, 57.1 ml Eisessig, ad 1000 ml H O
- TRIS-Puffer 1: 1.5 M TRIS mit 0.4 % SDS, pH 8.8
- TRIS-Puffer 2: 0.5 M TRIS mit 0.4 % SDS, pH 6.8
- Trypsin-EDTA-Mixtur zum Ablösen adhärenter Zellen: # 17-16F von Lonza, CH
- Western Blotting Puffer (MPI): 20 µl MeOH, 20 µl Blotting Puffer MPI (5x), ad 100 ml H2O
- Zellkulturplatten, Beschichtungslösung für neuronale: PBS mit 0.2 mg/ml Poly-D- Lysin (# P7886 von Sigma-Aldrich, MO, USA), 2 µg/ml Laminin (# L2020 von Sigma-Aldrich, MO, USA)

iii. Verwendete Primär-Software

- LaTeX, Version 2£
- Microsoft Office Word und Excel, 2007
- DNA STAR MegAlign, EditSeq und MapDraw
- OriginPro 8E
- Python 2.7
- Wolfram Mathematica 8

Bibliographie

i. Veröffentlichte Artikel

BAR-NUN, S. et al. (1983): “G-418, an elongation inhibitor of 80 S ribosomes” in Biochim. Biophys. Acta Bd. 741

BERG D. E. et al. (1975): “Transposition of R factor genes to bacteriophage lambda” in Proc. Natl. Acad. Sci. U S A 72 (9)

BERTANI, G. (2004): “Lysogeny at mid-twentieth century: P1, P2, and other experimental systems” in: J. Bacteriol. Bd. 186, Nr. 3

CHAKRABARTI R, SCHUTT C. E. (2001): “The enhancement of PCR amplification by low mo- lecular-weight sulfones” in Gene 274 (1–2)

CHIEN, A., EDGAR, D. B., TRELA, J. M. (1976). “Deoxyribonucleic acid polymerase from the ex- treme thermophile Thermus aquaticus“ in J. Bacteriol. 127 (3)

CHUNG, W.-J. et al. (2008): “Endogenous RNA Interference Provides a Somatic Defense against Dro- sophila Transposons” in Current Biology, Vol. 18, Issue 11

COLOGNATO, H., YURCHENCO, P. D. (2000): “Form and Function: The Laminin Family of Heterotrimers” in Developmental Dynamics 218

DAVIES, J., WRIGHT, J. D. (1997): “Bacterial resistance to aminoglycoside antibiotics” in Trends in Mi- crobiology Vol. 5 Nr. 6

DULL, T. et al. (1998): “A Third-Generation Lentivirus Vector with a Conditional Packaging System” in J. Virol. 72 (11)

ELIAS, G. M. et al. (2006): “Synapse-Specific and Developmentally Regulated Targeting of AMPA Re- ceptors by a Family of MAGUK Scaffolding Proteins” in Neuron 52

FELGNER, P. L. et al. (1984): “Lipofectin: A highly efficient, lipid-mediated DNA/transfection procedure“ in Proc. Natl. Acad. Sci. U S A Vol. 84

FOECKING, M. K., HOFSTETTER, H. (1986): “Powerful and versatile enhancer-promoter unit for mamma- lian expression vectors” in Gene 45

FOMINA, S. et al. (2011): “Self-directed assembly and clustering of the cytoplasmic domains of inwardly rectifying Kir2.1 potassium channels on association with PSD-95” in Biochim. Biophys. Acta 1808 (10)

GLUZMAN, Y. (1981): “SV40-transformed Simian Cells Support the Replication of Early SV40 Mutants” in Cell 23

HAASNOOT, J., WESTERHOUT E. M., BERKHOUT, B. (2007): “RNA interference against viruses: strike and counterstrike” in Nature – Biotechnology 25, Nr. 12

HANAHAN, D. (1983): “Studies on Transformation of Escherichia coli with Plasmids” in J Mol Biol

HEUPEL, K. et al. (2008): “Loss of transforming growth factor-beta 2 leads to impairment of central syn- apse function” in Neural Development, BioMedCentral

HILPERT, K. et al. (2001): “Anti-c-myc antibody 9E10: epitope key positions and variability character- ized using peptide spot synthesis on cellulose” in PEDS Vol. 14, Issue 10

HOLMES, A. et. al. (2010): “Association of Mouse Dlg4 (PSD-95) Gene Deletion and Human DLG4 Gene Variation With Phenotypes Relevant to Autism Spectrum Disorders and Williams’ Syndrome” in Am. J. Psychiatry 167 (12)

HOPP, T. P. et al. (1988): “A Short Polypeptide Marker Sequence Useful for Recombinant Protein Iden- tification and Purification” in Nature Biotechnology 6

IUPAC, International Union of Pure and Applied Chemistry and International Union of Biochemistry (1984): „Nomenclature and Symbolism for Amino Acids and Peptides“ in Pure & Appl. Chem. 56

JENSEN, F. C. et al. (1964): “Infection of Human and Simian Tissue Cultures with Rous Sarcoma Virus” in Proc. Natl. Acad. Sci. U S A 52

KARRA, D., DAHM, R. (2010): “Transfection Techniques for Neuronal Cells” in The Journal of Neurosci- ence 30 (18)

KENT, K. P., CHILDS, W., BOXER, S. G. (2008): “Deconstructing Green Fluorescent Protein” in J. Am. Chem. Soc. Vol. 130, Nr. 30

KHVOROVA, A., REYNOLDS, A., JAYASENA, S. D. (2003): “Functional siRNAs and miRNAs exhibit strand bias” in Cell 115 (2)

KIM, E., SHENG, M. (2004): “PDZ Domain Proteins of Synapses” in Nature Reviews – Neuroscience 5

KIM, M. J. et al. (2007): “Synaptic Accumulation of PSD-95 and Synaptic Function Regulated by Phos- phorylation of serine-295 of PSD-95” in Neuron Vol. 56, Issue 3

KRISTIANSEN, L. V., MEADOR-WOODRUFF, J. H. (2005): “Abnormal striatal expression of transcripts encoding NMDA interacting PSD proteins in schizophrenia, bipolar disorder and major depression” in Schizophrenia Research 78

KURRECK, J. (2009): “RNA Interference: From Basic Research to Therapeutic Applications” in Angew. Chem. Int. Ed., Vol. 48, Issue 8

LAPTEVA, N. et al. (2005): “CXCR4 knockdown by small interfering RNA abrogates breast tumor growth in vivo” in Cancer Gene Therapy 12

LIN-CHAO, S., CHEN, W. T., WONG, T. T. (1992): „High copy number of the pUC plasmid results from a Rom/Rop-suppressible point mutation in RNA II” in Molecular Microbiology 6(22)

MERÉNYI, G., LIND, J., ERIKSEN, T. E. (1990): “Lumino1 Chemiluminescence: Chemistry, Excitation, Emitter” in J. of Bioluminescence & Chemiluminescence Vol. 5, Issue 1

MIYOSHI, H. et al. (1998): “Development of a self-inactivating lentivirus vector” in J. Virol. 72 (10)

PHELPS, P. C., ELLIGET, K. A., TRUMP, B. F. (1996): “Cytoskeletal alteration following chemical ische- mia” in FASEB J. 10

REINHARDT, C. G., KRUGH, T. R. (1978): “A comparative study of ethidium bromide complexes with dinucleotides and DNA: direct evidence for intercalation and nucleic acid sequence preferences” in Biochemistry 17 (23)

ROSSI, R. et al. (1997): “Functional characterization of the T4 DNA ligase: a new insight into the mech- anism of action” in Nucl. Acids Res. 25 (11)

SHENG, M., HOOGENRAAD, C. C. (2007): “The Postsynaptic Architecture of Excitatory Synapses: A More Quantitative View” in Annu. Rev. Biochem. 76

SONTHEIMER, E. J., CARTHEW, R. W. (2005): “Silence from within: endogenous siRNAs and miRNAs” in Cell 122, Nr. 1

SUZUKI, Y., CRAIGIE, R. (2007): “The road to chromatin – nuclear entry of retroviruses” in Na- ture Rev. Microbiol. 5 (3)

THANBICHLER, M., WANG, S., SHAPIRO, L. (2005). “The bacterial nucleoid: a highly organized and dy- namic structure” in J. Cell Biochem. 96 (3)

TOPINKA, J. R., BREDT, D. S. (1998): “N-Terminal Palmitoylation of PSD-95 Regulates Association with Cell Membranes and Interaction with K+ Channel Kv1.4” in Neuron Vol. 20, Issue 1

TRUMP B. E. et al.: “The Pathways of Cell Death: Oncosis, Apoptosis, and Necrosis” in Toxicol. Pathol. Vol. 25, Nr. 1

TSIEN, R. Y., C SHANER, N. C., STEINBACH, P. A. (2005): „A guide to choosing fluorescent proteins” in Nature – Methods Vol. 2, Nr. 12

YANG, Linjing et al. (2004): “Critical role of magnesium ions in DNA polymerase beta's closing and ac- tive site assembly” in J. Am. Chem. Soc. 126 (27)

YANG, Lili et al. (2006): “Targeting lentiviral vectors to specific cell types in vivo” in Proc. Natl. Acad. Sci. U S A Vol. 103 Nr. 31

YU, J.-Y., DERUITER, S. L., TURNER, D. L. (2002): “RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells” in Proc. Natl. Acad. Sci. U S A Vol. 99, Nr. 9

ii. Sammelwerke

BERG, J. M., TYMOCZKO, J. L., STRYER, L.: Biochemie, Spektrum Akademischer Verlag (Heidelberg 52003)

BRONSTEIN, I. N.; SEMENDJAJEW, K. A.: Taschenbuch der Mathematik, Verlag Harri Deutsch (Thun, Frankfurt a. M., 221985),

EHLERS, E.: Analytik II, Deutscher Apothekerverlag (Stuttgart, 91999)

FUCHS, G. (Hrsg.): Allgemeine Mikrobiologie, Georg Thieme Verlag (Stuttgart 82007)

KANDEL, E., SCHWARTZ, J. H., JESSEL, T. M.: Principles of Neural Science, McGraw-Hill (New York, NY, 42000)

MADIGAN, M. T. et al.: BROCK Mikrobiologie, Spektrum Akademischer Verlag (Heidelberg, Berlin 92001)

MODROW, S., FALKE, D., TRUYEN, U.: Molekulare Virologie, Spektrum Akademischer Verlag (Heidelberg 22003)

MÜHLHARDT, C.: Der Experimentator: Molekularbiologie/Genomics, Spektrum Akademischer Verlag (Heidelberg 62009)

SAMBROOK, J., FRITSCH, E. F., MANIATIS, T. (1989): Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY, 31989) WATSON, J. D. et al.: Molekularbiologie, Pearson Studium (München 62011)

WIBERG, N., HOLLEMANN, A. F. (Begr.): Lehrbuch der anorganischen Chemie, Verlag Walter de Gruyter (Berlin, 91-1001985)

iii. Benutzerhandbücher

Becton, Dickinson & Co.: BD FACSCalibur, Nutzerbroschüre (2009)

BioLine GmbH: BIO-X-ACT Long DNA Polymerase. Information sheet (o. J.) Clontech Laboratories, Inc:

pmCherry-1 Vector Information, Protocol # PT3976-5, Version # PR882569 (2008),

pEGFP-N1 Vector Information, Protocol # PT3027-5, Version # PR93634 (1999)

Eppendorf AG: PerfectPrep Gel Cleanup Manual (2002)

Leica Microsystems: External Fluorescence Light SourceWith Metal Halide Bulb: Leica EL6000 (o. J.) OligoEngine: pSuper Manual. A Vector System for Expression of Short Interfering RNA (o. J.) PerkinElmer, Inc.: Western Lightning – Enhanced Chemoluminescence Substrates for Western Blotting,

Benutzeranweisung (o. J.)

QIAGEN, Inc.: QIAprep Miniprep Handbook (2006),

Plasmid Purification Handbook (2005)

Roche Life Sciences: PVDF Western Blotting Membranes. User´s manual, Version 7 (2011) Stratagene/Agilent Technologies, Inc.: pCMV-Tag Epitope Tagging Mammalian Expression Vectors.

Instruction Manual, Revision A (o. J.)

Thermo Fisher Scientific, Inc.: NanoDrop 1000 Spectrophotometer V3.7 User’s Manual (2008)

iv. Quellen im Netz

Abcam: Website des Antikörperherstellers, www.abcam.com

Addgene: Vektor-Datensammlung, www.addgene.org

EMBL-EBI: Website des European Bioinformatics Institute, Teil des European Molecular Biology La- boratory, www.ebi.ac.uk

ExPASy: Bioinformatics Resource Portal des SIB Swiss Institute of Bioinformatics, www.expasy.org

GESTIS: Stoffdatenbank des Instituts für Arbeitsschutz der Deutschen Gesetzlichen Unfallversicherung (IFA), www.gestis.itrust.de

Invitrogen: Hersteller-Homepage, www.lifetechnologies.com/de

MIT CFCR: pLL3.7 auf der Website des Massachusetts Institute of Technology – Center for Cancer Research, web.mit.edu/jacks-lab/protocols/pll37.htm

NCBI: Website des National Institute for Biotechnology Information, www.ncbi.nlm.nih.gov

NEB: Website der NewEngland BioLabs, Inc., www.neb.com

NIH Gene: Gendatenbank der National Institutes of Health, www.ncbi.nlm.nih.gov/gene

Nobelprize: offizielle Homepage des NOBELpreiskommittees, www.nobelprize.org

PDB: PSD-95-Struktur in der PDB Protein Data Bank der Research Collaboratory for Structural Bioin- formatics (RCSB), http://www.rcsb.org/pdb/explore/explore.do?structureId=2XKX

RKI: Homepage des Robert-Koch-Bundesinstituts für Infektionskrankheiten, www.rki.de

SienceGateway, Link- und Quellenverzeichnis für biomedizinische Wissenschaft und Forschung, www.sciencegateway.org/

Sigma-Aldrich: Hersteller-Website, www.sigmaaldrich.com

Uni.Liv.: pEYFP-N1 auf der Website des Physiologie-Departements der University of Liverpool, www.liv.ac.uk/physiology/ncs/catalogue/Cloning/pEYFP-N1-Map.htm

UniProt: universal protein database, www.uniprot.org

UCI: Tabelle spektraler Absorptions- und Emissionsmaxima Verschiedener Pigmente auf der Homepage der University of California, Irving, http://dbc.bio.uci.edu/obcresources/fluorophores.pdf

UCSF: Homepage des MCMANUS-Labors an der University of California, San Francisco, http://mcmanuslab.ucsf.edu/protocols

v. Sonstiges

LOCKAU, W.: Fachbereich Biochemie, Inst. f. Biologie der HU zu Berlin, WiSe 2011/2012

EITINGER, Th.: Fachbereich Mikrobiologie, Inst. f. Biologie der HU zu Berlin, WiSe 2011/2012

SCHATTAT, B.: Scriptum zum Physikalischen Grundpraktikum, FB Physik der FU Berlin, Ausgabe vom 20. 3. 2008

Danksagung

Zuallererst danke ich Frau Prof. Dr. Shoichet – Sarah – für die Möglickeit, meine Bachelorarbeit in ihrer Arbeitsgruppe „Molekulare Neurobiologie und -genetik“ anfertigen zu dürfen. Es war wirklich eine schöne Zeit und eine unglaubliche Bereicherung für mich.

Auch Herrn Prof. Dr. Brecht möchte ich an dieser Stelle meinen Dank aussprechen, dass er die HU- interne Betreuung meiner Arbeit übernommen hat.

Mein ganz besonderer Dank gilt Dr. Rademacher und Dr. Kunde aus der AG Shoichet: Nils, vielen Dank für die ausgezeichnete Begleitung meiner Arbeit und die großartige Unterstützung während der Experimente. Stella, ein herzliches Dankeschön für die unzähligen Ratschläge und manche Aushilfe. Insbesondere möchte ich auch Melanie Fuchs danken, die mir stets mit Rat und Tat beistand.

Auch der Studienstiftung des deutschen Volkes und nicht zuletzt meinen Eltern sei an dieser Stelle gedankt. Ohne ihre Förderung wäre mein Studium in vielerlei Hinsicht nicht in dieser Form möglich gewesen.

[...]


1 Ein durchschn. Neuron verfügt über Verbindungen zu ca. 1000 anderen Neuronen [KANDEL, Prin. Neur. Sci.].

2 AMPA-Rezeptoren sind bei Aktivierung permeabel für Na+, NMDA- und Kainat-Rezeptoren sowohl für Na+, als auch für Ca++ [ebd.].

3 Man siehe hierzu z. B. Fig. 6 in [HEUPEL, 2008].

4 Von engl. postsynaptic density.

5 Aus: [SHENG, 2007], S. 839, e. Ü.

6 Für ihre Entdeckung dieses Mechanismus´ in den 1990er Jahren wurden wurden die US-Amerikaner Andrew Z. FIRE und Craig C. MELLO 2006 mit dem Nobelpreis für Physiologie oder Medizin geehrt [Nobelprize, 11.10.2012].

7 Eigentlich ausgewählt wird bevorzugt der Strang mit niedrigerer thermodynamischer Stabilität, d. h. einem niedri- geren G/C-Gehalt an seinem 5´-Ende [KHVOROVA, 2003]. Dieser wird erst a posteriori als Leitstrang bezeichnet.

8 „Eine Vielzahl von Transposons springt, indem ihre DNA zunächst transkribiert, dann mittels reverser Transkriptase wieder in DNA umgeschrieben und an einer anderen Stelle ins Genoms inseriert wird. Da jedoch oft ein Teil der RNA doppelsträngig ist, wird sie von der RNAi-Maschinerie erkannt.“ (Das Karolinska Institutet zum Medizin-Nobelpreis 2006, e. Ü.)

9 Im menschlichen Genom finden sich viele Hundert Gene, die für kleine RNA-Partikel, sog. microRNAs, kodieren, welche Schnipsel anderer Gene enthalten und Doppelstrangstrukturen ausbilden können. Sie lösen RNAi aus und unterdrücken so die Expression des Gens am Herkunftsort des Schnipsels. (ebd., sowie [SONTHEIMER, 2005])

10 Die Fähigkeit zu diesem aktiven Transportprozess [SUZUKI, 2007] stellt den Grund dafür dar, dass Lentiviren im Gegensatz zu vielen anderen Viren dazu in der Lage sind, Zellen zu infizieren, die sich nicht gerade in Teilung befinden. Dadurch erhöht sich natürlich auch die Ausbeute an Zellen, bei denen das Konstrukt tatsächlich in den Nukleus gelangt, deutlich.

11 Bei Verwendung anderer infizierter Zelllinien als Neuronen, die sich noch weiter teilen, bietet das zusätzlich den Vorteil, dass das inserierte Gen auch auf die Tochtergenerationen vererbt wird.

12 Berechnet mit EMBOSS Needle [EMBL-EBI, 7.10.2012]

13 Kunstwort aus C. aethiops und origin-defective SV40

14 Für genauere Angaben, die Zusammensetzungen verwendeter Medien betreffend, beachte man auch den Anhang.

15 Von TPP Techno Plastic Products AG, CH.

16 Egtl. Trypsin-EDTA. Dieses soll auch im folgenden immer gemeint sein, selbst wenn lapidar von „Trypsin“ die Rede ist. EDTA = Ethylendiamintetraacetat ist ein sechszähniger Chelatbildner, der beigefügt wird, um möglicherweise vorhandene (Schwer-)Metallionen (Wasserhärte, etc.) komplex zu binden, welche sonst möglicherweise eine Hemmung der Enzymaktivität verursachen könnten [HOLLEMANN · WIBERG, Anorg. Chem.].

17 Für die Inhibition des Trypsins speziell ist das fötale Kälberserum im Nährmedium verantwortlich. Das erklärt auch die Notwendigkeit des Waschschritts der adhärenten Zellen mit DPBS vor der Trypsinierung: Das Serum enthält u. a. α1-Antitrypsin, welches im Körper neben Trypsin auch andere Proteasen wie Elastase hemmt und so Körpergewebe vor diesen Peptidasen zu schützen vermag, wenn sie z. B. in Entzündungsreaktionen von neutrophilen Granulozyten sezerniert werden [STRYER et al., Biochemie].

18 Die Laminine bilden eine Familie von heterotrimeren Glycoproteinen, die in nahezu allen Geweben von den Zellen in den extrazellulären Raum sezerniert werden, wo sie Selbstaggregation zeigen und so ein dichtes Netzwerk ausbilden. Sie wechselwirken mit Zelloberflächenproteinen sowie zahlreichen anderen Proteinen der extrazellulären Matrix und fördern dadurch die Zelladhäsion sowie bei Neuronen die Ausbildung von Neuriten [COLOGNATO, 2000].

19 Die klassischen Antibiotika Neomycin und Kanamycin sind bakterizide Amino-Triglyceride, die irreversibel an die 30 S-Untereinheit der bakteriellen Ribosomen binden [DAVIES, 1997], somit die Translation hemmen und antibiotisch gegen Prokaryota wirken. Geneticin ist ein Antibiotikum i. w. S. [MADIGAN, Brock Mikrobiol.]: Es wird zwar von Mikroben gebildet, jedoch wirkt es nicht exklusiv für andere Bakterien, sondern auch für höhere Organismen toxisch, da es auch an deren 80 S-Ribosomenuntereinheit zu binden vermag und somit das Wachstum eukaryotischer Zellen hemmt [BAR-NUN, 1983].

20 Tatsächlich spezifiziert der Hersteller nicht genauer, was für ein Resistenzgen eingesetzt wird. Allerdings beruhen fast alle Aminoglycosid-Resistenzen auf dem Mechanismus der enzymatischen Modifikation [DAVIES, 1997]. Evtl. handelt es sich sogar um dieselbe Resistenzkassette wie auf dem pEYFP-N1-Vektor, aus Tn5.

21 In der Literatur oft auch pmCherry oder nur mCherry.

22 Dazu gehören z. B. eine Anpassung des Codon-Gebrauchs durch stille Mutationen, die Einführung von KOZAK- Konsensussequenzen und 3´-terminalen Polyadenylierungssequenzen [Clontech, 1999].

23 Ampicillin gehört zur Gruppe der β-Lactam-Antibiotika und wirkt damit als Substratanalogon zum D-Alanyl-D- Alanin, welches in der Querkette des Peptidoglycans der bakteriellen Zellwand vorkommt. Durch seine irreversible Bindung an die Transpeptidase unterbindet Ampicillin die Quervernetzung der Mureinhülle, was zur Lysis wachsender Zellen führt; daher seine bakteriostatische Wirkung [EITINGER]. Die Resistenz beruht wahrscheinlich auf der Produktion und Ausscheidung einer β-Lactamase. (Hinweis darauf: Auf Amp-Platten wurde um Kolonien mit der Amp-Resistenz die Ausbildung von antibiotikafreien Höfen beobachtet, auf denen auch fremde Bakterien wachsen konnten.)

24 Es existieren ein 3- und ein 4-Plasmidsystem [MIT CFCR, 5.10.2012]. Auf je mehr Plasmide die Informationen zur Produktion der Viruspartikel verteilt sind, desto sicherer ist das System tendentiell, denn die Wahrscheinlichkeit, dass es durch multiple homologe Replikation zur Bildung erneut replikationskompetenter Viren kommt, sinkt.

25 Diese bilden die notwendigen Enhancer- und Promotorstrukturen für die RNA-Pol II [MODROW, Mol. Vir.].

26 Das KD-Konstrukt für Renilla-Luziferase wurde entworfen und kloniert von Nils Rademacher, AG Shoichet. Die shRNA-Sequenz für den KD von eGFP geht zurück auf Didier Trono, EPF Lausanne, CH und wurde ebenfalls von N. Rademacher nach dessen Vorbild kloniert.

27 Ebenfalls BioTeZ Berlin Buch GmbH.

28 Lag das Augenmerk besonders auf der Auftrennung kleiner DNA-Fragmente von unter 1 kBp Länge, wurde die Konzentration auf bis zu 2 % erhöht.

29 Ethidiumbromid, ein Phenanthridin-Derivat, ist ein heterozyklischer, roter Farbstoff, der bei Bestrahlung mit UV- Licht Fluoreszenz im sichtbaren Spektrum zeigt (maximale Emissionsintensität bei 595 nm [UCI, 5.10.2012]). Interkalation des Moleküls in Nukleinsäuren verstärkt die Fluoreszenzintensität [REINHARDT, 1978].

30 Die Anwesenheit von Mg2+-Ionen während der Replikation ist für die Funktion der DNA-Polymerase essentiell [YANG, 2004].

31 DMSO = Dimethylsulfoxid (CH3)2SO ist eine Thionylverbindung, die die störende Bildung von Sekundärstruk- turen in der DNA-Matrize unterdrückt und so die Ausbeute und Spezifität der PCR erhöht [CHAKRABARTI, 2001].

32 Dabei handelt es sich um eine optimierte Variante der Taq-DNA-Polymerase [BioLine, o. J.], welche aus dem thermophilen, gramnegativen Bakterium Thermus aquaticus stammt [CHIEN, 1976] und seine maximale Umsatz- geschwindigkeit um die 70 °C erreicht.

33 Diese DNA-Ligase stammt ursprünglich aus dem Bacteriophagen T4 und ist sowohl in der Lage, überhängende, als auch glatte Enden miteinander zu ligieren [ROSSI, 1997].

34 Der hypothetische Mechanismus für die Aufnahme der DNA hinter dieser Methode besteht darin, dass durch die Salzbehandlung zum einen die COULOMB-Abstoßung zwischen der negativ geladenen DNA und der außen ebenfalls negativ polarisierten Zellmembran reduziert wird und zum anderen die in diesem Milieu schwerlösliche DNA u. a. auf der Zelloberfläche ausfällt. Durch den Hitzeschock wird die Zellmembran kurzzeitig perforiert, sodass die DNA ins Zellinnere gelangen kann [EITINGER].

35 Eingesetzt wurde Ampicillin oder Kanamycin in Verdünnungen von 1:1000.

36 Die genomische DNA der Bakterien („Bakterienchromosom“) liegt, im Gegensatz zur plasmidären DNA, im kernäquivalenten Nukleoid [THANBICHLER, 2005], welches an der Cytoplasmamembran verankert ist und so nach der Lyse zusammen mit den Resten der Membran abgeschieden werden kann.

37 Die aromatischen Aminosäuren in Proteinen zeigen eine starke Lichtabsorption bei 260 nm. Deswegen ist z. B. das „260/280-Verhältnis“ ein bekanntes Maß für die Reinheit von Proteinen gegenüber Nukleinsäuren und vice versa. Auch DNA-Verunreinigungen mit Phenolen und anderen bei 280 nm absorbierenden Stoffen können so detektiert werden.

38 Das Opti-MEM-Medium, das bei der Lipofektion zum Einsatz kommt, enthält als Puffer HEPES = 2-(4-(2- Hydroxyethyl)-1-piperazinyl)-ethansulfonsäure mit einem pKS-Wert von 7.48 bei 35 °C [Sigma-Aldrich, 8.10.2012].

39 Auch immortale Laborzelllinien büßen mit der Zahl ihrer Teilungen an Vitalität ein. Während der Experimente konnten z. T. erhebliche Unterschiede hinsichtlich der Transfektions- und Überlebensraten festgestellt werden; generell fielen sie bei neu aufgetauten Aliquots aus einer niedrigen Passage derselben Linie wesentlich höher aus.

40 Dieser enthält u. a. SDS (Natriumlaurylsulfat, H3C— (CH2)11—O—SO3¯ Na+), ein einfach anionisches Detergens, welches „fast alle nichtkovalenten Wechselwirkungen innerhalb nativer Proteine zerstört“ und in einem rel. konstanten Verhältnis von ca. einem Molekül pro zwei Aminosäuren an das Protein bindet, sowie β-Mercapto- ethanol, HS—(CH2)2—OH, welches vorhandene Disulfidbrücken zu freien Thiolen reduziert [STRYER, Biochemie].

41 Sichtbar durch die intensive Farbe des Bromphenolblaus im SDS-PAGE-Puffer. Dabei handelt es sich um einen Säure-Base-Indikator, der bereits im Sauren bei pH 3 – 4.6 umschlägt [EHLERS, Analytik] und so bei moderaten pH- Werten im deprotonierten Zustand vorliegt, dementsprechend eine negative Ladung trägt und im elektrischen Feld aufgrund seiner geringen Größe schneller als die meisten Proteine zur Anode wandert.

42 Im folgenden wird diese Blocklösung kurz und ganz suggestiv als „Milch“ bezeichnet.

43 Die Verdünnung ist von der eingesetzten Antikörper-Charge abhängig; in vielen Fällen jedoch beträgt sie 1:5000.

44 Wahrscheinlich aus der Disproportionierung von H2O2 („klassische“ Luminol-Chemolumineszenzreaktion), allerdings kommen auch andere, alternative Peroxide infrage. Über die genaue Zusammensetzung der Reagenzien gibt der Hersteller indessen keine Auskunft.

45 Tubulin-Eintrag (IPR000217) in [EMBL-EBI, 1.10.2012].

46 Dieser erkennt die kurze As-Sequenz Glu-Glu-Phe(OH) der tyrosinierten Form einer Alpha-Tubulin-Untereinheit [Abcam, 23.10.2012].

47 DLG3 besteht wie PSD-95 aus drei PDZ-Domänen, eine SH3-Domäne und einer Guanylatkinase-ähnliche Domäne. Mit einer Länge von 849 As und ca. 93,5 kDa ist es lediglich ein wenig schwerer als das 724 As lange PSD-95 (Ratte, Isoform 1) mit ca. 80,5 kDa [UniProt, 6.9.2012]. Insgesamt stimmen die beiden Eiweiße in 65 % aller Aminosäuren überein (blastp Protein-BLAST [NCBI, 6.9.2012]).

48 Es ist möglich, dass bei Optimierung des Blots ähnlich gute Resultate erzielt werden können wie mit dem Stressgen-Antikörper; Stella-Amrei Kunde etwa berichtete von guten Erfahrungen mit dem NeuroMab-Antikörper bei wesentlich geringeren PSD-95-Mengen im Blot.

49 Die Hg-Halogenid-Lampe weist drei starke Intensitätsmaxima zw. 350 und 450 nm, sowie zwei Peaks zw. 550 und 600 nm auf [Leica, o. J.].

50 De facto stehen in dem Gerät zwei verschiedene Anregungslaser zur Verfügung, zwischen denen je nach eingesetz- tem Fluorophor entschieden wird. Der erste Laser liefert blaues Licht der Wellenlänge 488 nm, der zweite rotoranges von 635 nm [FACSCalibur, 2009].

51 Wie auch im folgenden: Sequenzierung durch Fa. LGC Genomics GmbH, Berlin.

52 Da EcoRI und SalI inkompatible 5´-Basenüberhänge schneiden [NEB, 11.9.2012], kann das Insert nur in der richtigen Orientierung ins Rückgrat eingebaut werden. Da das Insert zudem eine ausreichende Größe hat, sind im Anschluss religierte Produktplasmide ohne das Insert sowie jene, die es tragen, auf dem Agarosegel leicht zu identifizieren. Auf eine CIP-Behandlung vor der Ligation kann deshalb – wie auch im folgenden häufig – verzichtet werden.

53 Wie auch im folgenden wurde dieser Anteil bestimmt mithilfe der FACS-Analysesoftware.

54 FLAG-PSD-95 ist mit ca. 83 kDa leichter als pCherry-PSD-95 mit ca. 109 kDa (berechnet mit Translate Tool [ExPASy, 1.10.2012] und Protein Molecular Weight Calculator [ScienceGateway, 1.10.2012]).

55 Dass dem nicht immer so sein muss, zeigt bspw. das kontraintuitive Wanderungsverhalten von DLG3 und PSD-95 (Abbildung 18). Hier läuft das DLG3 leicht unterhalb des über 10 kDa leichteren PSD-95.

56 pKS von 8.2 bei RT, im Trenngel eingestellt auf pH 8.8, d. h. im leicht basischen Milieu.

57 Split-Varianten von fluoreszenten Proteinen bieten breite Anwendungsmöglichkeiten, etwa für Kolokalisations- versuche. Entsprechend gut untersucht sind solche Defekt-Varianten; bspw. reichten KENT et al. die Entfernung nur eines von 11 Bändern aus der Faßstruktur, um die Fluoreszenz von GFP komplett auszuschalten [KENT, 2008].

58 Die tatsächlichen Epitope auf pCherry, an die die polyklonalen Antikörper binden, unterscheiden sich voneinander. Die nachgewiesene Antigen-Antikörper-Reaktion zeigt, dass zumindest ein kleiner Teil des Proteins translatiert worden sein muss.

59 “Creating RNAi stem loops for LentiLox 3.7” [UCSF, 15.5.2012]

60 von 60 Seiten

Details

Titel
Manipulation der Expression neuronaler Gerüstproteine mittels RNA-Interferenz
Hochschule
Humboldt-Universität zu Berlin  (Institut für Biologie)
Note
1,7
Autor
Jahr
2013
Seiten
60
Katalognummer
V491807
Sprache
Deutsch
Reihe
Aus der Reihe: e-fellows.net stipendiaten-wissen
Schlagworte
RNA interference, Molecular Biology, Genetics, Neurobiology
Arbeit zitieren
Maximilian Sohmen (Autor), 2013, Manipulation der Expression neuronaler Gerüstproteine mittels RNA-Interferenz, München, GRIN Verlag, https://www.grin.com/document/491807

Kommentare

  • Noch keine Kommentare.
Im eBook lesen
Titel: Manipulation der Expression neuronaler Gerüstproteine mittels RNA-Interferenz


Ihre Arbeit hochladen

Ihre Hausarbeit / Abschlussarbeit:

- Publikation als eBook und Buch
- Hohes Honorar auf die Verkäufe
- Für Sie komplett kostenlos – mit ISBN
- Es dauert nur 5 Minuten
- Jede Arbeit findet Leser

Kostenlos Autor werden