Grin logo
de en es fr
Shop
GRIN Website
Publish your texts - enjoy our full service for authors
Go to shop › Agrarian Studies

Molecular phylogenetic studies of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) and family comparison using rbcL sequence analysis

Summary Excerpt Details

The Cucurbitaceae family is the one of the economically important groups of plants in the tropics and subtropics. Molecular phylogenetic analysis was advanced after the introduction of molecular markers which give much precise results in analysis. Our current study based on the amplification of RuBisco enzyme using rbcL primer and subsequent validation using BLAST, FASTA and CLUSTAL-W in pumpkin and winter melon. The isolated and purified DNA samples were PCR amplified using rbcL primer and later sequenced using ABI Prism 377 DNA sequencer.

Multiple sequence alignment algorithms and distance matrix were constructed using rbcL sequences in FASTA format were retrieved from GenBank. Phylogenetic tree was created using the distance based neighbour joining (NJ) and clustering algorithms method. The agarose gel electrophoresis were used to separate the isolated as well as PCR amplified DNA samples. The sequences obtained after sequencing were subjected to BLAST similarity search and multiple sequence alignment using CLUSTAL-W.

The construction of divergence matrix and phylogenetic dendrograms revealed two main groups, one consisting of MC and other Momordica species while the other group consisted of three subgroups of CM, CG and BH having members of Cucurbita, Coccinia and Momordica respectively. The reliability of molecular phylogenesis can be affected by myriad, long branch attraction, saturation and taxon sampling problems. So the selection of the models plays a key step in the success analysis.

In general, the present study unambiguously confirmed the existence of Coccinia grandis as a distinct species and morphologic separation between Coccinia grandis and other selected members of Cucurbitaceae as separate species was evident. Among the species included in the present study Coccinia grandis undergone maximum divergence during the process of evolution. More detailed work on the evolution within the Cucurbitaceae needed for crop improvement.

Excerpt


Table of contents

Acknowledgements

Table of figures

Table of tables

List of abbreviations

SPSS : Statistical package for social sciences

Molecular phylogenetic studies of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) and family comparison using rbcL sequence analysis

Abstract

1. Introduction

2. Materials and methods
2.1 Plant samples collection
2.2 Analysis of the sequences BLAST and Clustal-W
2.3 Construction of phylogenetic tree
2.4 Statistical analysis

3. Results

4. Discussion

5. Conclusions

Acknowledgements

References

Acknowledgements

Firstly we thank God Almighty whose blessing were always with us and helped us to complete this project work successfully.

We wish to thank our beloved Manager Rev. Fr. Dr. George Njarakunnel, Respected Principal Dr. Joseph V.J, Vice Principal Fr. Joseph Allencheril, Bursar Shaji Augustine and the Management for providing all the necessary facilities in carrying out the study. We express our sincere thanks to Mr. Binoy A Mulanthra (lab in charge, Department of Biotechnology) for the support. This research work will not be possible with the co-operation of many farmers.

We are gratefully indebted to our teachers, parents, siblings and friends who were there always for helping us in this project.

Prem Jose Vazhacharickal*, Sajeshkumar N.K, Jiby John Mathew, Linta Jose and lakshmi M Nair

*Address for correspondence

Assistant Professor

Department of Biotechnology

Mar Augusthinose College

Ramapuram-686576

Kerala, India

premjosev@gmail.com

Table of figures

Figure 1. Map of the sample collection area represented by a star symbol.

Figure 2. a) Bitter gourd (Momordica charantia) fruits, b) Bitter gourd flowers, c) Coccinia grandis developing fruit, d) Coccinia grandis harvested mature fruits, e) winter melon (Benincasa hispida) fruit, f) Cucurbita maxima fruit. Photo courtesy: Wikipedia.

Figure 3. a) Agarose gel electrophoresis of the isolated DNA samples and b) PCR amplified DNA samples from bitter gourd. c) Agarose gel electrophoresis of the isolated DNA samples and d) PCR amplified DNA samples from ivy gourd.

Figure 4. Blast analysis of the query sequence obtained by subjecting the amplified PCR products of bitter gourd which are sequenced by ABI377 sequencer.

Figure 5. Multiple sequence alignment of the 17 input sequences using MEGA4 software with sequences bootstrapped to 390 base pairs (bitter gourd).

Figure 6. Estimates of evolutionary divergences between 17 input sequences using maximum composite likelihood method in MEGA4 software (bitter gourd).

Figure 7. Evolutionary history of 17 taxa determined using neighbour-joining method (bitter gourd).

Figure 8. Multiple sequence alignment of the 16 input sequences and out-group using MEGA4 software with sequences bootstrapped to 300 base pairs (ivy gourd).

Figure 9. Multiple sequence alignment of the 16 input sequences and out-group using MEGA4 software with sequences bootstrapped to 440 base pairs (ivy gourd).

Figure 10. Estimates of evolutionary divergences between 16 input sequences and out-group using maximum composite likelihood method in MEGA4 software (ivy gourd).

Figure 11. Evolutionary history of 17 taxa determined using neighbour-joining method (ivy gourd).

Table of tables

Table 1. Components of the PCR reaction mixture

Table 2. PCR cycle for rbcL amplification

Table 3. Sequences in FASTA format retrieved from GenBank for multiple sequence alignment algorithms and construction of distance matrix for winter melon.

Table 4. Sequences in FASTA format retrieved from GenBank for multiple sequence alignment algorithms and construction of distance matrix for pumpkin.

List of abbreviations

illustration not visible in this excerpt

Molecular phylogenetic studies of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) and family comparison using rbcL sequence analysis

Prem Jose Vazhacharickal1*, Sajeshkumar N.K1, Jiby John Mathew1, Linta Jose1 and Lakshmi M Nair1

1 Department of Biotechnology, Mar Augusthinose College, Ramapuram, Kerala, India

* Corresponding author; premjosev@gmail.com

Abstract

The Cucurbitaceae family is the one of the economically important group of plants in the tropics and subtropics. Molecular phylogenetic analysis was advanced after the introduction of molecular markers which give much precise results in analysis. Our current study based on the amplification of RuBisco enzyme using rbcL primer and subsequent validation using BLAST, FASTA and CLUSTAL-W in pumpkin and winter melon. The isolated and purified DNA samples were PCR amplified using rbcL primer and later sequenced using ABI Prism 377 DNA sequencer. Multiple sequence alignment algorithms and distance matrix were constructed using rbcL sequences in FASTA format were retrieved from GenBank. Phylogenetic tree was created using the distance based neighbour joining (NJ) and clustering algorithms method. The agarose gel electrophoresis were used to separate the isolated as well as PCR amplified DNA samples. The sequences obtained after sequencing were subjected to BLAST similarity search and multiple sequence alignment using CLUSTAL-W. The construction of divergence matrix and phylogenetic dendrograms revealed two main groups, one consisting of MC and other Momordica species while the other group consisted of three subgroups of CM, CG and BH having members of Cucurbita, Coccinia and Momordica respectively. The reliability of molecular phylogenesis can be affected by myriad, long branch attraction, saturation and taxon sampling problems. So the selection of the models plays a key step in the success analysis. In general, the present study unambiguously confirmed the existence of Coccinia grandis as a distinct species and morphologic separation between Coccinia grandis and other selected members of Cucurbitaceae as separate species was evident. Among the species included in the present study Coccinia grandis undergone maximum divergence during the process of evolution. More detailed work on the evolution within the Cucurbitaceae needed for crop improvement.

Keywords: Clustering algorithms; rbcL sequences; Multiple sequence alignmen t.

1. Introduction

Crop improvement has been advanced a lot with the evolution of Genetics, genomic and plant breeding. The Cucurbitaceae family has 118 genera and 825 species mainly distributed in the tropics and subtropics (Esteras et al., 2011; Jeffrey, 2005) which were characterized by five angled stem and coiled tendrils (Kocyan et al., 2007). The genus Cucurbita (2n = 2x = 40) has a great diversity in physiological and morphological characteristics (Robinson and Decker-Walters, 1997; Goldman, 2004; Gong et al., 2013). In the gourd family (Cucurbitaceae), flowers are unisexual with both monecious and dioecious plants (Schaefer and Renner, 2010). Research on Cucerbitaceae usually based on tendril branching (Jeffrey, 2005), pollen structure and seed coat characterization (Kocyan et al., 2007). The Cucurbitaceae has been considered as an ideal candidate for genetic scrutiny using molecular marker tools (Lebeda et al., 2007; Gong et al., 2013).

Momordica consist of 59 species, most of them are perennial climber, with monecious and dioecious species (Palada and Chang, 2003; Lokesha and Vasudeva, 2001; Schaefer and Renner, 2010). Molecular marker based researches were usually geographic, country specific while some research were done across the globe for worldwide genetic variations (Gwanama et al., 2000; Paris et al., 2003; Wu et al., 2011; Gong et al., 2012). Phylogenetic studies based on allozyme (Wilson, 1989), ribosomal intergenic spacer probes (Ruiz and Hemleben, 1991), chloroplast DNA (Wilson et al., 1992), and RAPDs (Baranek et al., 2000; Ferriol et al., 2003) are reliable and efficient tools for evolutionary relationships. Nuclear DNA markers are more reliable than organelle DNA due to the inheritance from both parents as well as meiotic recombination (Gong et al., 2013). Rubisco (Ribulose-1, 5-bisphosphate carboxylase oxygenase) is an enzyme found in plant chloroplast, has a vital function in Calvin cycle and glucose synthesis.

Differences in DNA sequences are used to determine the evolutionary relationship which based on phylogenic tree is a major part in molecular systematic. Comparison of homologous sequences for genes using sequence alignment techniques and data base search is a good indicator of degree of divergence during evolution. Given lacking information about molecular phylogeny of bitter gourd and ivy gourd, our objectives were to (1) amplify the genes producing the RuBisco enzyme using rbcL primer, (2) validation of the amplified genes using similarity searches including BLAST and FASTA and (3) interpretation of the software algorithms using CLUSTAL-W.

2. Materials and methods

2.1 Plant samples collection

Fresh plant materials of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) was collected from a local farm in Melukavu (Figure 1). Fresh leaves samples were collected in pre-sterilized autoclavable polyethylene bags (Himedia Laboratories, Mumbai, India) and stored in insulated boxes with gel ice packs during transportation. The samples were stored at -20°C till further analysis. For the extraction of DNA, alkaline lysis method (Kidwell and Osborn, 1992) followed by modified CTAB (Porebski et al., 1997) method. The quality of the isolated DNA was determined spectrophomertically using a double beam UV spectrophotometer (118, Systronics India Ltd, Ahmedabad, India) as well as 8% agarose gels, 1x TBE buffer in an agarose electrophoresis chamber (Geni Pvt, Bangalore, India).

The amplification of the extracted DNA were done using PCR machine (MJ Mini, BioRad, Gurgaon, India) according to the protocol of Zang and Renner (2003) using Taq Polymesase (Geni Pvt, Bangalore, India) and rbcL primer (Geni Pvt, Bangalore, India). The amplification performed in 25 µl of 25 µmol l-1 MgCl2 solution, 2.5 µl 10 x buffer (Geni Pvt, Bangalore, India), 2 µl of a 2.5 µmol l-1 dNTP solution, 1 µl of rbcL primer at 10 pmol µl-1, 1 unit (0.2 µl) of Taq Polymerase, and 1 µl of extracted DNA (Haas et al., 2003; Rychlik et al., 1990). The forward primer rbcL a F (5’ ATGTCACCACAAACAGAGACTAAAGC 3’) and reverse primer rbcL a R (5’ GTAAATCAAGTCCACCACG 3’).

After the PCR amplification, the PCR products were separated using agarose gel (1.5%) electrophoresis with a 100 base pair standard ladder DNA of 100 to 1000 BP (Geni Pvt, Bangalore, India). After agarose gel electrophoresis, the PCR products were trimmed from the gel, subsequently the gel was dissolved and later DNA was precipitated using 98% ethanol as precipitating agent (Meier et al., 1996; Erlich, 1989; Saiki, 1989). The purified DNA samples were later sequenced using ABI Prism 377 DNA sequencer (Applied Biosciences, NY, USA).

illustration not visible in this excerpt

Figure 1. Map of the sample collection area represented by a star symbol.

illustration not visible in this excerpt

Figure 2. a) Bitter gourd (Momordica charantia) fruits, b) Bitter gourd flowers, c) Coccinia grandis developing fruit, d) Coccinia grandis harvested mature fruits, e) winter melon (Benincasa hispida) fruit, f) Cucurbita maxima fruit. Photo courtesy: Wikipedia.

Table 1. Components of the PCR reaction mixture

illustration not visible in this excerpt

Table 2. PCR cycle for rbcL amplification

illustration not visible in this excerpt

2.2 Analysis of the sequences BLAST and Clustal-W

Basic Local Alignment Search Tool (BLAST) is used sensitive sequence similarity between sequences. The sample sequences in FASTA format were entered in field specified on BLAST algorithms home page. The BLAST output parameters were set to pre-determined settings and final output in Hyper Text Mark Up (HTML) format were used for further bioinformatics analysis.

Multiple sequence alignment programme Clustal-W 2.1 (University College of Dublin, Ireland). The process of Clustal multiple sequence analysis was advanced through pair wise alignment, construction of a distance matrix and display of base saturation in the matrix. The results were based on the pair wise analysis of 19 sequences using Maximum Composite Likelihood Method (Thompson et al., 1994; Chenna et al., 2003). Codon positions included were 1st + 2nd + 3rd + non coding sequences. Positions containing gaps and missing data were eliminated from the data set using complete deletion option to achieve high resolution phylogenetic tree construction.

In the case of bitter gourd, for precise results in the tree construction, 17 cucurbit samples and their respective rbcL sequences (GenBank) were included in the multiple sequence alignment algorithms along with Momordica charantia, Cucurbita maxima, Coccinia grandis and Benincasa hispida. For pumpkin, 15 cucurbit (other than Cucurbita argyrosperma) and an out-group Solanum melongena (brinjal) and their rbcL sequences in FASTA format were retrieved from GenBank. These were included in the multiple sequence alignment algorithms and in construction of distance matrix. The purpose of out-group is to increase the rate of interpretability of phylogenetic tree which shows maximum rate of evolutionary divergence.

Table 3. Sequences in FASTA format retrieved from GenBank for multiple sequence alignment algorithms and construction of distance matrix for winter melon.

illustration not visible in this excerpt

Table 4. Sequences in FASTA format retrieved from GenBank for multiple sequence alignment algorithms and construction of distance matrix for pumpkin.

illustration not visible in this excerpt

From the preliminary results of multiple sequence alignment and distance matrix, non-aligned and mismatched sequences were removed for better reliability. Further this makes the understand ability of evolutionary convergence and divergences of the selected samples as well as with the other 11 common cucurbits included.

2.3 Construction of phylogenetic tree

The evolutionary relationships can be best studied using a phylogenetic tree and was created using the distance based neighbour joining (NJ) and clustering algorithms. Multifurcating phylogenetic tree was constructed based on creating a distance matrix starting from the alignment and pair wise distances calculated between sequences from the obtained matrix.

2.4 Statistical analysis

Descriptive statistics using SPSS 12.0 (SPSS Inc., Chicago, IL, USA) were conducted to summarize the data and graphs were generated using Sigma Plot 7 (Systat Software Inc., Chicago, IL, USA).

3. Results

The isolated DNA were checked spectrophotometrically and with a purity values of 1.67 and with a concentration of 4,395 µgml-1. The agarose gel electrophoresis were used to separate the isolated as well as PCR amplified DNA samples (Figure 2). The sequences obtained after sequencing were subjected to BLAST similarity search and multiple sequence alignment using CLUSTAL-W.

The construction of divergence matrix and phylogenetic dendrograms revealed two main groups, one consisting of MC and other Momordica species while the other group consisted of three subgroups of CM, CG and BH having members of Cucurbita, Coccinia and Momordica respectively.

illustration not visible in this excerpt

Figure 3. a) Agarose gel electrophoresis of the isolated DNA samples and b) PCR amplified DNA samples from bitter gourd. c) Agarose gel electrophoresis of the isolated DNA samples and d) PCR amplified DNA samples from ivy gourd.

illustration not visible in this excerpt

Figure 4. Blast analysis of the query sequence obtained by subjecting the amplified PCR products of bitter gourd which are sequenced by ABI377 sequencer.

illustration not visible in this excerpt

Figure 5. Multiple sequence alignment of the 17 input sequences using MEGA4 software with sequences bootstrapped to 390 base pairs (bitter gourd).

illustration not visible in this excerpt

Figure 6. Estimates of evolutionary divergences between 17 input sequences using maximum composite likelihood method in MEGA4 software (bitter gourd).

illustration not visible in this excerpt

Figure 7. Evolutionary history of 17 taxa determined using neighbour-joining method (bitter gourd).

illustration not visible in this excerpt

Figure 8. Multiple sequence alignment of the 16 input sequences and out-group using MEGA4 software with sequences bootstrapped to 300 base pairs (ivy gourd).

illustration not visible in this excerpt

Figure 9. Multiple sequence alignment of the 16 input sequences and out-group using MEGA4 software with sequences bootstrapped to 440 base pairs (ivy gourd).

illustration not visible in this excerpt

Figure 10. Estimates of evolutionary divergences between 16 input sequences and out-group using maximum composite likelihood method in MEGA4 software (ivy gourd).

illustration not visible in this excerpt

Figure 11. Evolutionary history of 17 taxa determined using neighbour-joining method (ivy gourd).

4. Discussion

Phylogenetic nomenclature is a result of Darwins discovery that history of life can be best represented in tree-shaped diagrams. In the current era, the conventional phyolgenetic nomenclatures are supplemented with molecular biological tools which make the classification much more precise and accurate. In general the DNA or RNA sequencing gained superiority among evolutionary studies coupled with the support of Bioinformatics tools and software’s.

Currently, the sequencing of entire DNA of an organism is long and expensive process. A typical molecular phyolgenetic analysis require 1000 base pairs. At any location within such sequences, the bases found in a given position may vary between organisms. The particular sequences found in a given organism is referred as its halotype. In principle, since there are four base types, with 1000 base pair, there could have 41000 distinct halotypes. In a particular species or in a group of related species, there would have few variations and most of them are co-related with few distinct haplotypes.

Once divergences between all pairs of samples were determined, statistical cluster analysis and dendrogams examines the similarity among halotypes. Bootstrapping and jackknifing further increase the reliability estimates for the position of haplotypes within the evolutionary tree.

5. Conclusions

The reliability of molecular phylogenesis can be affected by myriad, long branch attraction, saturation and taxon sampling problems. So the selection of the models plays a key step in the success analysis. In general, the present study unambiguously confirmed the existence of Coccinia grandis as a distinct species and morphologic separation between Coccinia grandis and other selected members of Cucurbitaceae as separate species was evident. Among the species included in the present study Coccinia grandis undergone maximum divergence during the process of evolution. More detailed work on the evolution within the Cucurbitaceae is needed for crop improvement.

Acknowledgements

The authors are grateful for the cooperation of the management of Mar Augsthinose college for necessary support. Technical assistance from Binoy A Mulanthra is also acknowledged. We also thank an anonymous farmer for the supply of plant materials for our study.

References

Badola HK, Aitken S (2010). Biological resources and poverty alleviation in the Indian Himalayas. Biodiversity 11 (3-4) 8-18.

Baranek M, Stif, G, Vollmann J, Lelley T (2000). Genetic diversity within and between the species Cucurbita pepo, C. moschata and C. maxima as revealed by RAPD markers. Report-Cucurbit Genetics Cooperative 23 (1) 73-77.

Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic acids research, 31(13), 3497-3500.

Erlich HA (1989). PCR technology. Principles and applications for DNA amplification. Stockton press.

Esteras C, Nuez F, Picó B, YiHong W, Behera TK, Kole C (2011). Genetic diversity studies in Cucurbits using molecular tools. Genetics, Genomics and Breeding of Cucurbits 2 (1) 140-198.

Ferriol M, Pico MB, Nuez F (2003). Genetic diversity of some accessions of Cucurbita maxima from Spain using RAPD and SBAP markers. Genetic Resources and Crop Evolution 50 (3) 227-238.

Gong L, Paris HS, Nee MH, Stift G, Pachner M, Vollmann J, Lelley T (2012). Genetic relationships and evolution in Cucurbita pepo (pumpkin, squash, gourd) as revealed by simple sequence repeat polymorphisms. Theoretical and Applied Genetics 124 (5) 875-891.

Gong L, Paris HS, Stift G, Pachner M, Vollmann J, Lelley T (2013). Genetic relationships and evolution in Cucurbita as viewed with simple sequence repeat polymorphisms: the centrality of C. okeechobeensis. Genetic Resources and Crop Evolution 2 (1) 1-16.

Gwanama C, Labuschagn, MT, Botha AM (2000). Analysis of genetic variation in Cucurbita moschata by random amplified polymorphic DNA (RAPD) markers. Euphytica 113 (1) 19-24.

Haas SA, Hild M, Wright AP, Hain T, Talibi D, Vingron M (2003). Genome scale design of PCR primers and long oligomers for DNA microarrays. Nucleic acids Research 31 (19) 5576-5581.

Jeffrey C. (2005). A new system of Cucurbitaceae. Bot. Zhurn, 90, 332-335.

Kidwell KK, Osborn TC (1992). Simple plant DNA isolation procedures. In Plant genomes: methods for genetic and physical mapping (pp. 1-13). Springer Netherlands.

Kocyan A, Zhang LB, Schaefer H, Renner SS (2007). A multi-locus chloroplast phylogeny for the Cucurbitaceae and its implications for character evolution and classification. Molecular Phylogenetics and Evolution 44 (2) 553-577.

Lebeda A, Widrlechner MP, Staub J, Ezura H, Zalapa J, Krˇistkova E (2007). Cucurbits (Cucurbitaceae; Cucumis spp., Cucurbita spp., Citrullus spp.). In: Singh RJ (ed) Genetic resources, chromosome engineering, and crop improvement: vegetable crops. CRC Press, Boca Raton, pp 271–376

Meier A, Sander P, Bottger EC (1996). Protocol 4. Elimination of contaminating DNA within PCR reagents. PCR Essential Techniques, John Wiley & Sons, New York, 19.

Paris HS, Yonash N, Portnoy V, Mozes-Daube N, Tzuri G, Katzir N (2003). Assessment of genetic relationships in Cucurbita pepo (Cucurbitaceae) using DNA markers. Theoretical and Applied Genetics 106 (6) 971-978.

Porebski S, Bailey LG, Baum BR (1997). Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15 (1) 8-15.

Robinson RW, Decker-Walters DS (1997). Cucurbits. Cab international. Wallingford.

Ruiz RAT, Hemleben V (1991). Use of ribosomal DNA spacer probes to distinguish cultivars of Cucurbita pepo L. and other Cucurbitaceae. Euphytica 53 (1) 11-17.

Rychlik WJSW, Spencer WJ, Rhoads RE (1990). Optimization of the annealing temperature for DNA amplification in vitro. Nucleic acids Research 18 (21) 6409-6412.

Saiki RK (1989). The design and optimization of the PCR. PCR technology: Principles and applications for DNA amplification, 7-16.

Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids Research 22 (22) 4673-4680.

Wilson HD (1989). Discordant patterns of allozyme and morphological variation in Mexican Cucurbita. Systematic Botany 1 (2) 612-623.

Wu J, Chang Z, Wu Q, Zhan H, Xie S (2011). Molecular diversity of Chinese Cucurbita moschata germplasm collections detected by AFLP markers. Scientia Horticulturae 128 (1) 7-13.

Frequently asked questions

What is the study about?

The study focuses on the molecular phylogenetic analysis of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis), as well as a family comparison within the Cucurbitaceae family using rbcL sequence analysis. It explores genetic relationships and evolutionary divergences within these plants.

What methods were used in the study?

The study involved several methods, including: plant sample collection; DNA isolation and purification; PCR amplification using rbcL primers; DNA sequencing using an ABI Prism 377 DNA sequencer; sequence analysis using BLAST and Clustal-W; construction of phylogenetic trees; and statistical analysis.

What is rbcL and why is it used in this study?

rbcL refers to the gene that produces the RuBisCO enzyme (Ribulose-1,5-bisphosphate carboxylase/oxygenase). It is a commonly used gene for phylogenetic studies in plants due to its relatively conserved nature and ability to provide insights into evolutionary relationships.

What is BLAST used for in this study?

BLAST (Basic Local Alignment Search Tool) is used to find regions of similarity between the sequenced DNA samples and other known sequences in a database. This helps identify and validate the plant species and understand their evolutionary relationships.

What is Clustal-W used for in this study?

Clustal-W is a multiple sequence alignment program used to align DNA sequences from different samples. This alignment allows for the identification of conserved and variable regions, which are then used to construct phylogenetic trees.

How was the phylogenetic tree constructed?

Phylogenetic trees were constructed using distance-based neighbor-joining (NJ) and clustering algorithms. The construction involved creating a distance matrix based on the alignment of sequences and calculating pairwise distances between them.

What were the main findings of the study?

The study confirmed the existence of Coccinia grandis as a distinct species and highlighted the morphological separation between Coccinia grandis and other members of Cucurbitaceae. The study also indicated that among the species included, Coccinia grandis underwent maximum divergence during evolution.

What is the significance of this research?

This research contributes to a better understanding of the evolutionary relationships within the Cucurbitaceae family. This knowledge can be valuable for crop improvement efforts and for conservation strategies.

What are the key words associated with this study?

Clustering algorithms, rbcL sequences, Multiple sequence alignment.

Where were the samples collected?

Fresh plant materials of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) were collected from a local farm in Melukavu, Kerala, India.

Excerpt out of 24 pages  - scroll top

Buy now

Title: Molecular phylogenetic studies of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) and family comparison using rbcL sequence analysis

Scientific Study , 2017 , 24 Pages

Autor:in: Dr. Prem Jose Vazhacharickal (Author), Sajeshkumar N.K. (Author), Jiby John Mathew (Author), Linta Jose (Author), Lakshmi M. Nair (Author)

Agrarian Studies
Look inside the ebook

Details

Title
Molecular phylogenetic studies of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) and family comparison using rbcL sequence analysis
College
Mar Augusthinose College
Authors
Dr. Prem Jose Vazhacharickal (Author), Sajeshkumar N.K. (Author), Jiby John Mathew (Author), Linta Jose (Author), Lakshmi M. Nair (Author)
Publication Year
2017
Pages
24
Catalog Number
V351562
ISBN (eBook)
9783668382633
ISBN (Book)
9783668382640
Language
English
Tags
Clustering algorithms rbcL sequences Multiple sequence alignment
Product Safety
GRIN Publishing GmbH
Quote paper
Dr. Prem Jose Vazhacharickal (Author), Sajeshkumar N.K. (Author), Jiby John Mathew (Author), Linta Jose (Author), Lakshmi M. Nair (Author), 2017, Molecular phylogenetic studies of bitter gourd (Momordica charantia) and ivy gourd (Coccinia grandis) and family comparison using rbcL sequence analysis, Munich, GRIN Verlag, https://www.grin.com/document/351562
Look inside the ebook
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
  • Depending on your browser, you might see this message in place of the failed image.
Excerpt from  24  pages
Grin logo
  • Grin.com
  • Shipping
  • Contact
  • Privacy
  • Terms
  • Imprint
  • Withdraw Contract