Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida)

Family comparison using rbcL sequence analysis


Scientific Study, 2017

24 Pages


Excerpt

Table of contents

Acknowledgements

Table of figures

Table of tables

List of abbreviations

Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and Winter melon (Benincasa hispida): family comparison using rbcL sequence analysis

Abstract

1. Introduction

2. Materials and methods
2.1 Plant samples collection
2.2 Analysis of the sequences BLAST and Clustal-W
2.3 Construction of phylogenetic tree
2.4 Statistical analysis

3. Results

4. Discussion

5. Conclusions

Acknowledgements

References

Acknowledgements

Firstly we thank God Almighty whose blessing were always with us and helped us to complete this project work successfully.

We wish to thank our beloved Manager Rev. Fr. Dr. George Njarakunnel, Respected Principal Dr. Joseph V.J, Vice Principal Fr. Joseph Allencheril, Bursar Shaji Augustine and the Management for providing all the necessary facilities in carrying out the study. We express our sincere thanks to Mr. Binoy A Mulanthra (lab in charge, Department of Biotechnology) for the support. This research work will not be possible with the co-operation of many farmers.

We are gratefully indebted to our teachers, parents, siblings and friends who were there always for helping us in this project.

Prem Jose Vazhacharickal*, Sajeshkumar N.K, Jiby John Mathew, Anjana R and Dona Ann Johns

*Address for correspondence

Assistant Professor

Department of Biotechnology

Mar Augusthinose College

Ramapuram-686576

Kerala, India

premjosev@gmail.com

Table of figures

Figure 1. Map of the sample collection area represented by a star symbol

Figure 2. a) Bitter gourd (Momordica charantia) fruits, b) Bitter gourd flowers, c) Coccinia grandis developing fruit, d) Coccinia grandis harvested mature fruits, e) winter melon (Benincasa hispida) fruit, f) Cucurbita maxima fruit. Photo courtesy: Wikipedia

Figure 3. a) Agarose gel electrophoresis of the isolated DNA samples and b) PCR amplified DNA samples from winter melon. c) Agarose gel electrophoresis of the isolated DNA samples and d) PCR amplified DNA samples from pumpkin

Figure 4. Blast analysis of the query sequence obtained by subjecting the amplified PCR products of pumpkin which are sequenced by ABI377 sequencer

Figure 5. Multiple sequence alignment of the 19 input sequences using MEGA4 software with sequences bootstrapped to 180 base pairs (winter melon)

Figure 6. Estimates of evolutionary divergences between 19 input sequences using maximum composite likelihood method in MEGA4 software (winter melon)

Figure 7. Evolutionary history of 19 taxa determined using neighbour-joining method (winter melon)

Figure 8. Multiple sequence alignment of the 16 input sequences and out-group using MEGA4 software with sequences bootstrapped to 240 base pairs (winter melon)

Figure 9. Multiple sequence alignment of the 16 input sequences and out-group using MEGA4 software with sequences bootstrapped to 450 base pairs (winter melon)

Figure 10. Estimates of evolutionary divergences between 16 input sequences and out-group using maximum composite likelihood method in MEGA4 software (pumpkin)

Figure 11. Evolutionary history of 17 taxa determined using neighbour-joining method (pumpkin)

Table of tables

Table 1. Components of the PCR reaction mixture

Table 2. PCR cycle for rbcL amplification

Table 3. Sequences in FASTA format retrieved from GenBank for multiple sequence alignment algorithms and construction of distance matrix for winter melon

Table 4. Sequences in FASTA format retrieved from GenBank for multiple sequence alignment algorithms and construction of distance matrix for pumpkin

List of abbreviations

illustration not visible in this excerpt

Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and Winter melon (Benincasa hispida): family comparison using rbcL sequence analysis Prem Jose Vazhacharickal1*, Sajeshkumar N.K1, Jiby John Mathew1, Anjana R1 and Dona Ann Johns1

1 Department of Biotechnology, Mar Augusthinose College, Ramapuram, Kerala, India

* Corresponding author; premjosev@gmail.com

Abstract

The Cucurbitaceae family is the one of the economically important group of plants in the tropics and subtropics. Molecular phylogenetic analysis were advanced after the introduction of molecular markers which give much precise results in analysis. Our current study based on the amplification of RuBisco enzyme using rbcL primer and subsequent validation using BLAST, FASTA and CLUSTAL-W in pumpkin and winter melon. The isolated and purified DNA samples were PCR amplified using rbcL primer and later sequenced using ABI Prism 377 DNA sequencer. Multiple sequence alignment algorithms and distance matrix were constructed using rbcL sequences in FASTA format were retrieved from GenBank. Phylogenetic tree was created using the distance based neighbour joining (NJ) and clustering algorithms method. Once divergences between all pairs of samples were determined, statistical cluster analysis and dendrogams examines the similarity among halotypes. Bootstrapping and jackknifing further increase the reliability estimates for the position of haplotypes within the evolutionary tree.

Keywords: Clustering algorithms; rbcL sequences; Multiple sequence alignmen t.

1. Introduction

Genetics, genomic and plant breeding has been considered as three overlapping and complementary disciplines for crop improvement. The Cucurbitaceae family has 118 genera and 825 species mainly distributed in the tropics and subtropics (Esteras et al., 2011; Jeffrey, 2005) which are considered to be the economically important plant families (Kocyan et al., 2007). The genus Cucurbita (2n = 2x = 40) has a great diversity in physiological and morphological characteristics (Robinson and Decker-Walters, 1997; Goldman, 2004; Gong et al., 2013). Studies were conducted to characterize the various tribes of Cucurbitaceae based on tendril branching (Jeffrey, 2005), pollen structure and seed coat characterization (Kocyan et al., 2007). With the evolution and advancement of molecular marker tools, The Cucurbitaceae has been selected as an ideal candidate for genetic scrutiny (Lebeda et al., 2007; Gong et al., 2013).

Cucurbitaceae (gourd family) is an excellent example of a plant family with many useful species of agricultural importance that are cultivated worldwide. The earliest record of human use of edible cucurbits comes from habitations older than 9000 years and certainly by 3000 B.C. In the new world, squashes and pumpkins are used as major food crop by native people. This is an important family consisting of approximately 125 genera and 960 species, mainly in regions tropical and subtropical. Cucurbita fruits have yellow or orange flesh, which is rich in carotenoids, the compounds humans need to make vitamin A and our visual pigment rhodopsin.

A taxonomic investigation of the cucurbits (family-Cucurbitaceae) growing throughout the northern parts of Bangladesh was carried out. A total of 24 species under 13 genera of the family Cucurbitaceae were collected. A brief taxonomic account of each species is given with current nomenclature, local name, English name and uses. About the species Benincasa hispida, Citrullus lanatus, Coccinia grandis, Cucumis sativus, C. melo, Cucurbita maxima, Cucurbita argyrosperma, C. moschata, C. pepo, Lagenaria siceraria, Luffa acutangula, L. cylindrica, Momordica charantia, M. cochinchinesis, Melothria maderaspatana, Trichosanthes anguina, T. dioica,T. cucumerina, T. bracteata were abundant and Diplocyclos palmatus, Cucumis callosus, Thladianthacordifolia, Trichosanthes chordata, Gymnopetalum cochinchinense were very rare.

Most of the research done using molecular markers usually geographic, country specific while some research were done across the globe for worldwide genetic variations (Gwanama et al., 2000; Paris et al., 2003; Wu et al., 2011; Gong et al., 2012). Investigations based on allozyme (Wilson, 1989), ribosomal intergenic spacer probes (Ruiz and Hemleben, 1991), chloroplast DNA (Wilson et al., 1992), and RAPDs (Baranek et al., 2000; Ferriol et al., 2003). Nuclear DNA markers are more reliable than organelle DNA due to the inheritance from both parents as well as meiotic recombination (Gong et al., 2013). Rubisco (Ribulose-1, 5-bisphosphate carboxylase oxygenase) is an enzyme found in plant chloroplast, has a vital function in Calvin cycle and glucose synthesis.

The rbcL gene and protein sequences have been used in addressing systematic questions among the few selected members of the family Cucurbitaceae has been investigated. In order to elucidate the systematic positions, a set of chloroplast-rbcL nucleotide sequences (from 42 taxa of 7 genera) and aminoacid sequences (from 52 taxa of 10 genera) were withdrawn from GenBank and GenPept databases, respectively. The evolutionary distance was inferred from these sequences by employing Bootstrap method of UPGMA (Unweighted Pair Group Method with Arithmetic Mean) and MP (Maximum Parsimony) using MEGA (Molecular Evolutionary Genetic Analysis) software. From the separate analysis produced almost similar although not identical results, no strongly supported incongruent results. The members of the genus Austrobryonia showed strictly monophyletic, Trichosanthes, Luffa, Momordica and Coccinia are found to be paraphyletic. But the members of the genus Cucumis are distributed throughout these hiraeoid clades, confirming the polyphyly of this large genus observed in both the family trees. From the results, it is also clear that, the chloroplast-rbcL gene and aminoacid sequences resolved the relationships, as well as provided a good indication of major supra-generic groupings among the selected members of the family Cucurbitaceae

Molecular phylogentic approach which belongs to molecular systematic, uses the differences in DNA sequences to determine the evolutionary relationship based on phylogenic tree. Comparison of homologous sequences for genes using sequence alignment techniques and data base search is a good indicator of degree of divergence during evolution. Given lacking information about molecular phylogeny of pumpkin and winter melon, our objectives were to (1) Amplify the genes producing the RuBisco enzyme using rbcL primer, (2) validation of the amplified genes using similarity searches including BLAST and FASTA and (3) interpretation of the software algorithms using CLUSTAL-W.

2. Materials and methods

2.1 Plant samples collection

Fresh plant materials of pumkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida) was collected from a local farm in Melukavu (Figure 1). Fresh leaves samples were collected in pre-sterilized autoclavable polyethylene bags (Himedia Laboratories, Mumbai, India) and stored in insulated boxes with gel ice packs during transportation. The samples were stored at -20°C till further analysis. For the extraction of DNA, alkaline lysis method (Kidwell and Osborn, 1992) followed by modified C-TAB (Porebski et al., 1997) method. The quality of the isolated DNA was determined spectrophomertically using a double beam UV spectrophotometer (118, Systronics India Ltd, Ahmedabad, India) as well as 8% agarose gels, 1x TBE buffer in an agarose electrophoresis chamber (Geni Pvt, Bangalore, India).

The amplification of the extracted DNA were done using PCR machine (MJ Mini, BioRad, Gurgaon, India) according to the protocol of Zang and Renner (2003) using Taq Polymesase (Geni Pvt, Bangalore, India) and rbcL primer (Geni Pvt, Bangalore, India). The amplification performed in 25 µl of 25 µmol l-1 MgCl2 solution, 2.5 µl 10 x buffer (Geni Pvt, Bangalore, India), 2 µl of a 2.5 µmol l-1 dNTP solution, 1 µl of rbcL primer at 10 pmol µl-1, 1 unit (0.2 µl) of Taq Polymerase, and 1 µl of extracted DNA (Haas et al., 2003; Rychlik et al., 1990). The forward primer rbcL a F (5’ ATGTCACCACAAACAGAGACTAAAGC 3’) and reverse primer rbcL a R (5’ GTAAATCAAGTCCACCACG 3’).

After the PCR amplification, the PCR products were separated using agarose gel (1.5%) electrophoresis with a 100 base pair standard ladder DNA of 100 to 1000 BP (Geni Pvt, Bangalore, India). After agarose gel electrophoresis, the PCR products were trimmed from the gel, subsequently the gel was dissolved and later DNA was precipitated using 98% ethanol as precipitating agent (Meier et al., 1996; Erlich, 1989; Saiki, 1989). The purified DNA samples were later sequenced using ABI Prism 377 DNA sequencer (Applied Biosciences, NY, USA).

illustration not visible in this excerpt

Figure 1. Map of the sample collection area represented by a star symbol.

illustration not visible in this excerpt

Figure 2. a) Bitter gourd (Momordica charantia) fruits, b) Bitter gourd flowers, c) Coccinia grandis developing fruit, d) Coccinia grandis harvested mature fruits, e) winter melon (Benincasa hispida) fruit, f) Cucurbita maxima fruit. Photo courtesy: Wikipedia.

Table 1. Components of the PCR reaction mixture

illustration not visible in this excerpt

Table 2. PCR cycle for rbcL amplification

illustration not visible in this excerpt

2.2 Analysis of the sequences BLAST and Clustal-W

Basic Local Alignment Search Tool (BLAST) is used sensitive sequence similarity between sequences. The sample sequences in FASTA format were entered in field specified on BLAST algorithms home page. The BLAST output parameters were set to pre-determined settings and final output in Hyper Text Mark Up (HTML) format were used for further bioinformatics analysis.

[...]

Excerpt out of 24 pages

Details

Title
Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida)
Subtitle
Family comparison using rbcL sequence analysis
College
Mar Augusthinose College
Authors
Year
2017
Pages
24
Catalog Number
V351564
ISBN (eBook)
9783668383425
ISBN (Book)
9783668383432
File size
2280 KB
Language
English
Tags
molecular, cucurbita, benincasa, family
Quote paper
Dr. Prem Jose Vazhacharickal (Author)Sajeshkumar N.K (Author)Jiby John Mathew (Author)Anjana R (Author)Dona Ann Johns (Author), 2017, Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida), Munich, GRIN Verlag, https://www.grin.com/document/351564

Comments

  • No comments yet.
Read the ebook
Title: Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida)



Upload papers

Your term paper / thesis:

- Publication as eBook and book
- High royalties for the sales
- Completely free - with ISBN
- It only takes five minutes
- Every paper finds readers

Publish now - it's free