The Cucurbitaceae family is the one of the economically important group of plants in the tropics and subtropics. Molecular phylogenetic analysis were advanced after the introduction of molecular markers which give much precise results in analysis. Our current study based on the amplification of RuBisco enzyme using rbcL primer and subsequent validation using BLAST, FASTA and CLUSTAL-W in pumpkin and winter melon.
The isolated and purified DNA samples were PCR amplified using rbcL primer and later sequenced using ABI Prism 377 DNA sequencer. Multiple sequence alignment algorithms and distance matrix were constructed using rbcL sequences in FASTA format were retrieved from GenBank.
Phylogenetic tree was created using the distance based neighbour joining (NJ) and clustering algorithms method. Once divergences between all pairs of samples were determined, statistical cluster analysis and dendrogams examines the similarity among halotypes. Bootstrapping and jackknifing further increase the reliability estimates for the position of haplotypes within the evolutionary tree.
Table of Contents
Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and Winter melon (Benincasa hispida): family comparison using rbcL sequence analysis
Abstract
1. Introduction
2. Materials and methods
2.1 Plant samples collection
2.2 Analysis of the sequences BLAST and Clustal-W
2.3 Construction of phylogenetic tree
2.4 Statistical analysis
3. Results
4. Discussion
5. Conclusions
Research Objectives and Focus
This study aims to investigate the molecular phylogeny of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida) by analyzing rbcL gene sequences to clarify their systematic positions and evolutionary relationships within the Cucurbitaceae family.
- Amplification of RuBisco enzyme genes using rbcL primers.
- Validation of amplified genes through BLAST and FASTA similarity searches.
- Interpretation of sequence alignment algorithms using CLUSTAL-W.
- Construction and statistical analysis of phylogenetic trees and divergence matrices.
Excerpt from the Book
2.1 Plant samples collection
Fresh plant materials of pumkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida) was collected from a local farm in Melukavu (Figure 1). Fresh leaves samples were collected in pre-sterilized autoclavable polyethylene bags (Himedia Laboratories, Mumbai, India) and stored in insulated boxes with gel ice packs during transportation. The samples were stored at -20°C till further analysis. For the extraction of DNA, alkaline lysis method (Kidwell and Osborn, 1992) followed by modified C-TAB (Porebski et al., 1997) method. The quality of the isolated DNA was determined spectrophomertically using a double beam UV spectrophotometer (118, Systronics India Ltd, Ahmedabad, India) as well as 8% agarose gels, 1x TBE buffer in an agarose electrophoresis chamber (Geni Pvt, Bangalore, India).
The amplification of the extracted DNA were done using PCR machine (MJ Mini, BioRad, Gurgaon, India) according to the protocol of Zang and Renner (2003) using Taq Polymesase (Geni Pvt, Bangalore, India) and rbcL primer (Geni Pvt, Bangalore, India). The amplification performed in 25 µl of 25 µmol l-1 MgCl2 solution, 2.5 µl 10 x buffer (Geni Pvt, Bangalore, India), 2 µl of a 2.5 µmol l-1 dNTP solution, 1 µl of rbcL primer at 10 pmol µl-1, 1 unit (0.2 µl) of Taq Polymerase, and 1 µl of extracted DNA (Haas et al., 2003; Rychlik et al., 1990). The forward primer rbcL a F (5’ ATGTCACCACAAACAGAGACTAAAGC 3’) and reverse primer rbcL a R (5’ GTAAATCAAGTCCACCACG 3’).
Summary of Chapters
1. Introduction: Provides an overview of the Cucurbitaceae family, the importance of molecular markers in genetic studies, and the justification for investigating pumpkin and winter melon phylogeny.
2. Materials and methods: Details the procedures for sample collection, DNA extraction, PCR amplification, and the bioinformatics tools used for sequence analysis and phylogenetic tree construction.
3. Results: Presents the findings from DNA isolation, sequencing, and the subsequent construction of divergence matrices and phylogenetic dendrograms.
4. Discussion: Interprets the phylogenetic findings, emphasizing the importance of molecular tools in clarifying evolutionary relationships and the reliability of the methods employed.
5. Conclusions: Summarizes the study's impact, noting that model selection is crucial for evolutionary analysis and that further research is needed for crop improvement within the Cucurbitaceae family.
Keywords
Cucurbitaceae, Molecular Phylogeny, rbcL gene, DNA amplification, BLAST, CLUSTAL-W, Clustering algorithms, Phylogenetic tree, Sequence alignment, Genetic variation, Pumpkin, Winter melon, RuBisco, Evolutionary divergence, Bioinformatics.
Frequently Asked Questions
What is the core focus of this research?
This research focuses on performing molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida) to compare their family lineages using rbcL sequence analysis.
What are the primary thematic fields covered?
The study covers molecular systematics, plant genetics, sequence alignment algorithms, and evolutionary biology, specifically targeting the Cucurbitaceae family.
What is the primary goal of the study?
The goal is to elucidate the systematic positions of the selected species by amplifying the RuBisco enzyme using rbcL primers and constructing phylogenetic trees to determine evolutionary relationships.
Which scientific methods are applied?
The study utilizes PCR amplification, DNA sequencing via ABI Prism 377, sequence similarity searching (BLAST/FASTA), multiple sequence alignment (CLUSTAL-W), and statistical cluster analysis using MEGA4 and SPSS.
What topics are discussed in the main body?
The main body details the methodology for DNA sample collection and analysis, the computational steps for building distance matrices and phylogenetic trees, and a discussion on the accuracy of molecular biological tools in plant classification.
Which keywords characterize this work?
Key terms include molecular phylogeny, rbcL sequences, clustering algorithms, multiple sequence alignment, and Cucurbitaceae genetic diversity.
How were the DNA sequences validated?
The amplified DNA sequences were validated using similarity search tools including BLAST and FASTA, and interpreted using CLUSTAL-W algorithms to ensure precision in the alignment.
What role does the out-group play in this analysis?
An out-group, such as Solanum melongena, is used in the phylogenetic construction to increase the interpretability of the tree and to clearly show the rate of evolutionary divergence among the test taxa.
- Citar trabajo
- Dr. Prem Jose Vazhacharickal (Autor), Sajeshkumar N.K (Autor), Jiby John Mathew (Autor), Anjana R (Autor), Dona Ann Johns (Autor), 2017, Molecular phylogenetic studies of pumpkin (Cucurbita argyrosperma) and winter melon (Benincasa hispida), Múnich, GRIN Verlag, https://www.grin.com/document/351564